Labshake search
Citations for Addgene :
1 - 50 of 1243 citations for 6 chloro 9H 3 C methyl β D ribofuranosyl purine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... and ESRG (6 μg each) along with 3 μg of pMD2.G (gift from Dr. D. Trono; RRID:Addgene_12259) was transfected into PLAT-GP packaging cells ...
-
bioRxiv - Neuroscience 2022Quote: ... A pcDNA3 flag HA 14-3-3 β plasmid was a gift from William Sellers (Addgene plasmid # 8999 ...
-
bioRxiv - Neuroscience 2020Quote: ... (2) AAV1-hSYN-β-Arrestin2-TEV-C-P2A-TdTomato (Addgene Cat #: 89873), (3 ...
-
bioRxiv - Neuroscience 2022Quote: ... A pcDNA3 flag HA 14-3-3 β plasmid was a gift from William Sellers (Addgene plasmid # 8999; http://n2t.net/addgene:8999; RRID:Addgene_8999). All plasmids were verified by Sanger sequencing and/or long-read sequencing (Iowa IIHG Genomics core or Plasmidsaurus ...
-
bioRxiv - Neuroscience 2023Quote: ... neonatal Swiss Webster or C57Bl/6 (P0–3) mice were anesthetized on ice for 3 min before injecting viral vectors (AAV5.GfaABC1D.GCaMP6f.SV40 [Addgene, 52925-AAV5] ...
-
bioRxiv - Plant Biology 2023Quote: ... a C-terminal 3×FLAG® epitope tag (pICSL50007; Addgene #50308), and 3′ UTR and terminator sequences from Agrobacterium tumefaciens nopaline synthase (AtuNOST ...
-
bioRxiv - Neuroscience 2022Quote: ... The original CIRTs-6: B-defensin 3-TBP6.7-YTHDF2 plasmid (# 132544) was purchased from Addgene and the YTHDF2 domain was PCR amplified and cloned into the AgeI and NheI sites ...
-
bioRxiv - Molecular Biology 2023Quote: U2OS 2-6-3 D28N were generated by electroporation of pCMV_BE4max (Addgene #112093; Koblan et al., 2018) and phU6-gRNA expression cassette encoding the guide sequence AAGCGTCAGTCTGCCCTCCA (Addgene #53188 ...
-
bioRxiv - Genomics 2023Quote: ... All 3 of the 6 wells were transfected with 100 ng of pCAG-NLS-HA-Bxb1 (Addgene #51271) and 1,500 ng of donor attB library whereas the T25 was transfected with 1,000 ng of the Bxb1 containing plasmid and 5,000 ng attB library ...
-
bioRxiv - Cell Biology 2023Quote: For β-catenin isoform experiments: β-catenin34–87GFP construct was generated from the original plasmid MSCV-β-catenin-IRES-GFP (Addgene Plasmid #14717). These constructs were transfected into MEFs by Lipofectamine LTX&PlusTM (Invitrogene A12621) ...
-
bioRxiv - Cancer Biology 2022Quote: ... β-catenin shRNA was purchased from Addgene (pLKO.1 puro shRNA β-catenin #18803). Scramble siRNA and p68 siRNA were purchased from Santa Cruz Biotechnology (Santa Cruz ...
-
bioRxiv - Cancer Biology 2023Quote: ... FLAG-β-catenin K49R (Addgene plasmid # 44750 ...
-
bioRxiv - Cancer Biology 2023Quote: ... FLAG-β-catenin plasmid constructs were purchased from Addgene (FLAG-β-catenin WT (Addgene plasmid #16828 ...
-
bioRxiv - Cell Biology 2022Quote: ... U2OS 2-6-3 were transduced with pLenti CMV rtTA3 Blast (w756-1, plasmid #26429; Addgene, gift from E. Campeau) for the expression of rtTA ...
-
bioRxiv - Cell Biology 2022Quote: ... we added a signal peptide at the N-terminus of Breg and a 6×His tag at its C-terminus using pHL-sec vector (Addgene)39 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Xenopus β-catenin-GFP (Addgene #16839), Xenopus cNLS-β-catenin-GFP (Addgene #16838) ...
-
bioRxiv - Developmental Biology 2021Quote: ... GST-human β-catenin (Addgene #24193), and NLS-mCherry (Addgene #49313 ...
-
bioRxiv - Cell Biology 2022Quote: ... pAc-GFPC1-Sec61 β (Addgene #15108) was inserted into pFRB-mCherry-C1 using BglII and EcoRI ...
-
bioRxiv - Synthetic Biology 2022Quote: ... β-Lactamase gene (amplified from Addgene plasmid RRID ...
-
bioRxiv - Cancer Biology 2023Quote: ... FLAG-β-catenin K19R (Plasmid #Addgene plasmid # 44749 ...
-
bioRxiv - Cancer Biology 2023Quote: ... FLAG- β-catenin K19R/K49R(Addgene plasmid #44751 ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’-GGG GGG GGC GGA ATT CTC AGT CTA TCT TTT CTT TCT GGA CCA GTC TGG GAG C-3’ and pmScarlet-C1 (gift from Dorus Gadella; Addgene plasmid # 85042; http://n2t.net/addgene:85042; RRID:Addgene_85042) and GFP-TM(SAC1 ...
-
bioRxiv - Molecular Biology 2024Quote: ... CASFx-1 (RBFOX1N-dCasRx-C) and CASFx-3 (dCasRx-RBM38) were obtained from Addgene (Plasmid #118635 and #118638). RBFOX1N-dPspCas13b-C was constructed previously 13 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... pKB12 was constructed by replacing the LEU2 auxotrophic cassette of pDEST-DHFR F[3]-C (LEU2) (Addgene #177796) (Marchant et al ...
-
bioRxiv - Cell Biology 2021Quote: ... Expression vectors for NFAT4 D-site variants were prepared by subcloning residues 3 – 407 of WT NFAT4 from the corresponding mammalian expression vector (Addgene #21664) into pGEX4T1 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Xenopus cNLS-β-catenin-GFP (Addgene #16838), GST-human β-catenin (Addgene #24193) ...
-
bioRxiv - Cell Biology 2019Quote: ... and mCherry-Sec61 β (Addgene plasmid # 49155) were obtained from Drs ...
-
bioRxiv - Synthetic Biology 2020Quote: ... encoding β-glucuronidase (GUS; pICSL80016, Addgene #50332) and a C’-terminal yellow fluorescent protein (YFP ...
-
bioRxiv - Genetics 2024Quote: ... and β-arrestin 2-mYFP (Addgene #36917). FUZ-mCherry was generated by sub-cloning with XhoI/BamHI into mCherry2-N1 backbone vector (Addgene #54517) ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’-GGG GGG GGC GGA ATT CTC AGT CTA TCT TTT CTT TCT GGA CCA GTC TGG GAG C-3’ and pmScarlet-C1 (gift from Dorus Gadella; Addgene plasmid # 85042 ...
-
bioRxiv - Immunology 2021Quote: ... Full length FOXN1 cDNA without a stop codon was cloned into vector backbones positioning at its C-terminus either a flag (pCSF107mT-GATEWAY-3’-FLAG, Addgene), myc (pCSF107mT-GATEWAY-3’-Myc tag ...
-
bioRxiv - Genetics 2019Quote: ... Only a single site upstream of the c(3)GccΔ1 deletion was selected (AAAGCTTTGTTGGCCTGTATTGG) and constructed into the pU6-BbsI-chiRNA guide RNA (gRNA) plasmid (Addgene 45946). Sense (CTTCGAAAGCTTTGTTGGCCTCTAT ...
-
bioRxiv - Genetics 2019Quote: ... and guide 2 c(3)GccΔ3: TCTTGAACAACAATCTGTCAAGG) and constructed into the pU6-BbsI-chiRNA guide RNA (gRNA) plasmid (Addgene 45946). Sense and antisense oligonucleotides (guide 1 c(3)GccΔ2 ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV2/6 (Addgene #110660), pAAV2/6m (20) ...
-
bioRxiv - Cancer Biology 2021Quote: shRNA against β-catenin was purchased from Addgene (pLKO.1 puro shβ-catenin ...
-
bioRxiv - Biochemistry 2021Quote: ... The plasmids pmCherry-β-actin (Addgene #54967, RRID:Addgene_54967) and pmCardinal-paxillin (Addgene #56171 ...
-
bioRxiv - Biochemistry 2021Quote: ... The plasmids pmCherry-β-actin (Addgene #54967, RRID:Addgene_54967) and pmCardinal-paxillin (Addgene #56171 ...
-
bioRxiv - Cell Biology 2019Quote: ... GFP-β-catenin was from Addgene (Cambridge, MA) and GFP empty vector was a kind gift from Dr ...
-
bioRxiv - Cell Biology 2019Quote: ... pEGFP-N1:Importin-β was obtained by Addgene, made by Patrizia Lavia (plasmid # 106941) ...
-
bioRxiv - Plant Biology 2022Quote: ... or the β-glucuronidase (GUS) control (Addgene #50332), were assembled with pICH85281 [mannopine synthase promoter+W (MasWpro) ...
-
bioRxiv - Cancer Biology 2023Quote: shRNA against β-catenin was purchased from Addgene (pLKO.1 puro shβ-catenin ...
-
bioRxiv - Biochemistry 2021Quote: ... The PCR products were used as templates for final PCR using 5’ GGGGTACCGAA GTAAAACTTTAACTTCA G 3’ and 5’ CCGCTCGAGCTAATGATGATGATGATGATGC AATCCCCGAGACTTGTA C 3’ primer pair (KpnI and XhoI sites are underlined respectively) and cloned into pIB3 vector (cat # 25452, Addgene, USA). Similar strategy was used for PGAPDH-PEPCKDPRPEPCKMyc construct generation ...
-
bioRxiv - Synthetic Biology 2023Quote: ... D-sup (Addgene #90019) and DMC1 (CRG ORFome collection ...
-
bioRxiv - Microbiology 2021Quote: ... 2017 #6} (Addgene, Cat#1000000115), and verified by PCR ...
-
bioRxiv - Physiology 2023Quote: ... 6 μg of psPAX2 (Addgene), and 15 μg of pLV6-BMAL1-Luc vector (Addgene) ...
-
bioRxiv - Cancer Biology 2022Quote: Sleeping beauty based β-catenin N90 (ΔN90) (Addgene; 31785), YAP (Addgene ...
-
bioRxiv - Cell Biology 2022Quote: The coding sequences of β-tubulin-HaloTag (Addgene #64691) and mCherry-p50 were cloned into a puromycin-resistant lentiviral vector (Addgene #114021 ...
-
bioRxiv - Cancer Biology 2023Quote: ... FLAG-β-catenin plasmid constructs were purchased from Addgene (FLAG-β-catenin WT (Addgene plasmid #16828 ...
-
bioRxiv - Biochemistry 2023Quote: The β-lactamase plasmid (pExp-Bla, Addgene plasmid #112561) was expressed in E ...
-
bioRxiv - Systems Biology 2024Quote: ... or rabbit α-β-tubulin (Addgene ab6046, 1:10,000) as primary and HRP-α-Mouse (Cell Signaling ...