Labshake search
Citations for Addgene :
201 - 250 of 1893 citations for 6 N CARBETHOXY 3 CHLORO 7 8 DIHYDRO 5H PYRIDO 4 3 C PYRIDAZINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... 3) AAV1.hSyn.GCamP6s.WPRE.SV40 (6.67×1012 GC/kg, Addgene #100843). Before puncturing a capillary of interest ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 3 μg of plasmid VSVG (Plasmid #8454, Addgene). Cells were incubated at 37°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 3 μg of plasmid VSVG (Plasmid #8454, Addgene) in a 10 cm dish ...
-
bioRxiv - Genomics 2023Quote: ... 16 ug of plasmid were prepared for each plate at a ratio of 4:3:1 (sgRNA library: psPAX2(Addgene ID 12259): pMD2G(Addgene ID 12260)) ...
-
bioRxiv - Biochemistry 2021Quote: ... P1-8 and Photobacterium damselae were cloned into pNIC28-Bsa4 (N-terminal polyhistidine tag; Addgene #26103 (60)) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 4–1026 bp for the N-terminus and 2578–4563 bp for the C-terminus) was subcloned into C-Flag-pcDNA3 (Addgene, plasmid # 20011 ...
-
bioRxiv - Cell Biology 2019Quote: ... Lamin A-mEmerald (mEmerald-LaminA-N-18) and NLS-mCherry (mCherry-Nucleus-7) were gifts from Michael Davidson (Addgene plasmids #54139 and #55110 ...
-
bioRxiv - Biophysics 2022Quote: ... The plasmid MApple-LC-Myosin-N-7 was a gift from Michael Davidson (Addgene plasmid 54920; http://n2t.net/addgene : 54920; RRID : Addgene_54920). The plasmid MCherry-Actin-C-18 was a gift from Michael Davidson (Addgene plasmid 54967 ...
-
bioRxiv - Cell Biology 2020Quote: ... and the ER localization marker mCherry-ER-3 (Addgene: 55041) for 2 days ...
-
bioRxiv - Molecular Biology 2020Quote: ... mEmerald-ER-3 was a gift from Michael Davidson (Addgene plasmid # 54082 ...
-
bioRxiv - Genomics 2021Quote: ... 10 µg D8.9 and 3 µg pCMV-VSV-G (Addgene) packaging plasmids using Lipofectamine LTX with Plus Reagent (Thermo Fisher) ...
-
bioRxiv - Cell Biology 2021Quote: GFP-tagged galectin 3 (pEGFP-hGal3 (Addgene, plasmid no. 73080) was mutated using the Q5 site directed mutagenesis kit (New England Biolabs ...
-
bioRxiv - Neuroscience 2022Quote: ... and (3) mKok amplified from pCS2+ ChMermaid S188 (Addgene 53617) with the CAAX membrane tag sequence (Sutcliffe et al. ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 3 µg MSCV CreERT2 puro (Addgene, 2276 ref (18)) and polybrene (8 µg/mL ...
-
bioRxiv - Biochemistry 2020Quote: pHA#852: mec-4p∷FynY531F∷unc-54 3’UTR (Addgene ID ...
-
bioRxiv - Neuroscience 2021Quote: ... The 1208 bp rab-3 promoter sequence (Addgene Plasmid #110880) was inserted directly upstream of the N-terminal TOMM-20 coding region ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 3 μg pMD2.G (gift from Didier Trono, Addgene #12259), 12 μg of pCMV delta R8.2 (gift from Didier Trono ...
-
bioRxiv - Microbiology 2022Quote: ... were generated by annealing two primers ordered from IDT DNA and cloned using BbsI into pKSB-sgRNA (Addgene #173671—3) vectors containing the U6 snRNA polymerase III promoter (AGAP013557) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and TGFBR2 (5’-ccttgtagacctcggcgaag-3’) cloned into LentiCRISPRv2 puro (Addgene) (20) ...
-
bioRxiv - Neuroscience 2023Quote: ... Suppl Fig 3: AAV9-CaMKIIa-hChR2-EYFP (1:5, Addgene viral prep #26969- AAV9 ...
-
bioRxiv - Cancer Biology 2023Quote: Toronto Knockout Version 3 library was purchased from Addgene (#90294) (26) ...
-
MYB68 orchestrates cork differentiation by regulating stem cell proliferation and suberin depositionbioRxiv - Plant Biology 2024Quote: ... and 3) the P336-FBP_11 vector (Available from AddGene (#139702)) ...
-
bioRxiv - Cell Biology 2022Quote: ... GGAACAAGTTCAGTGAACTG, #3: TGCATGCTCACTGATAATGA), IFIH1 (#1: CTTGGACATAACAGCAACAT, #2: TGAGTTCCAAAATCTGACAT) or TLR3 (#1: ACGACTGATGCTCCGAAGGG, #2: ACTTACCTTCTGCTTGACAA, #3: GGAAATAAATGGGACCACCA) and control gRNAs (Addgene plasmid #51763, #51762 and #51760) were ligated into pLentiCRISPRv2 (Addgene plasmid # 52961 ...
-
bioRxiv - Cell Biology 2023Quote: ... The plasmid MApple-LC-Myosin-N-7 was a gift from Michael Davidson (Addgene plasmid 54920; http://n2t.net/addgene : 54920; RRID : Addgene 54920). The plasmid MCherry-Actin-C-18 was a gift from Michael Davidson (Addgene plasmid 54967 ...
-
bioRxiv - Biochemistry 2022Quote: CRISPR-Cas9-mediated gene ablation was carried out using a guide RNA targeting Cmas exon 4 (5’-TGTCGACGAGGCCGTTTCGC-3’) in the plasmid pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene plasmid #42230 from Feng Zhang) as used before.11 TSC were cotransfected with GFP-expressing plasmid peGFP-CI (Clontech ...
-
bioRxiv - Neuroscience 2024Quote: ... polyA_R, Table 3) and plasmid backbone (Col1E_F, Col1E_R, Table 4) were amplified from pPRISM-Stop-cmlc2-eGFP (Addgene kit #1000000154; Wierson et al., 2020). The PCR-amplified fragments were assembled using NEBuilder HiFi DNA Assembly Cloning Kit (E5520S ...
-
bioRxiv - Microbiology 2023Quote: ... 6 µg of 4:2:1:1 transfer:Gag-Pol (pMDLg-pRRE, Addgene):Rev (pRSV-Rev ...
-
bioRxiv - Cancer Biology 2022Quote: ... sgRNA constructs for ANKLE1 knockout were generated by inserting oligonucleotides containing the targeted sequences (5′-TTCAGGGCACAGCCTAGAAC -3′ and 5′-GATTCT-GCCCTAGCCCCACC -3′) into the pX458 vector (Addgene Plasmid #48138 (Ran et al. 2013)) ...
-
bioRxiv - Cell Biology 2020Quote: ... mEmerald-N-Wasp-C-18 and mEmerald-Coronin1B from Michael Davidson (Addgene plasmids #54199, 54050), pmCherry-C1-WIP from Anna Huttenlocher ...
-
bioRxiv - Immunology 2022Quote: ... We first cloned the N- and C-termini of NFAT5 isoform A synthetized by Addgene into a pMSGV retroviral vector ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV1-EF1a-N-CretrcintG and AAV1-EF1a-C-CreintG were gifts from Connie Cepko (Addgene viral prep # 69570-AAV1 and 69571-AAV1 ...
-
bioRxiv - Biochemistry 2023Quote: ... N-terminal or C-terminal heptahistidine (His7) tags were added using pQLinkH (Addgene plasmid 13667) or a modified derivative ...
-
bioRxiv - Cell Biology 2020Quote: ... we generated derivatives of pCFD5:U6:3-t::gRNA (Addgene, #73914). A first derivative (pCFD5:U6:3-t::gRNA_pst-1 ...
-
bioRxiv - Genetics 2021Quote: Calu-3 cells were transduced with lenti Cas9-Blast (Addgene #52962), or with lenti dCAS-VP64_Blast (Addgene #61425) ...
-
bioRxiv - Neuroscience 2022Quote: ... a 3:1 mixture of AAV-CAG-Flex-oG (Addgene #74292) and ΔG-Rab-GFP was injected into either the GS or TA muscles of P1-P2 pups ...
-
bioRxiv - Cancer Biology 2021Quote: pcDNA3.1-Myoferlin-HA and peGFP-hGalectin-3 was purchased from Addgene (plasmid no ...
-
bioRxiv - Neuroscience 2023Quote: ... and pC-(lox2-attB2-SA-T2A-Gal4-Hsp70)3 (Addgene #62957) were gifts from Benjamin H ...
-
bioRxiv - Biochemistry 2023Quote: The plasmid used to express Cas1 and Cas2/3 (Addgene #89240) was PCR amplified with mutagenic primer pairs using Q5 polymerase (NEB ...
-
bioRxiv - Genetics 2023Quote: ... pCFD4-U6:1_U6:3 was a gift from Simon Bullock (Addgene plasmid #49411 ...
-
bioRxiv - Microbiology 2023Quote: ... pCfB2904(XI-3 MarkerFree) was a gift from Irina Borodina (Addgene plasmid # 73276 ...
-
bioRxiv - Neuroscience 2023Quote: ... we injected 3×100 nl AAV5.Ef1a.DIO.eYFP (Penn Core, Addgene: 27056) into the mPFC (AP/ML/DV coordinates 2.2 ...
-
bioRxiv - Neuroscience 2023Quote: ... PV-cre mice received unilateral injections in the left lobule simplex of 0.7 µl of pAAV-1-hSyn1-Flex-SIO-stGtACR2-FusionRed-dlox (N = 5, 2.0 × 1012 genome copies/mL; Addgene: 105677-AAV1), while another group of PV-cre mice received injections of pAAV-9/2-hSyn1-dlox-tdTomato-dlox-WPRE (N = 3 ...
-
bioRxiv - Genetics 2022Quote: ... The plasmid encoding the sgRNA n°8 used in this study is available on Addgene (BPK1520-sgRNA GLB1, Addgene #184378).
-
bioRxiv - Genetics 2023Quote: ... Various Npu intein-split ABE constructs were cloned into N- and C-terminal AAV vectors (Addgene plasmids 137177 and 137178 ...
-
bioRxiv - Cell Biology 2020Quote: ... an sgRNA (5’-TTGGCACGCCTCCTCAGGCA-3’) was sub-cloned into PX458 (Addgene, 48138). The C-terminal region of the CENP-E gene was amplified with the following primers ...
-
bioRxiv - Developmental Biology 2021Quote: ... or exon 3 of TET3 and cloned into pX330 vector (Addgene #42230) as previously described 47 ...
-
bioRxiv - Developmental Biology 2019Quote: ... 3 µg of the pX-EGFP-g1 expression plasmid (Addgene plasmid #107273)28 was transfected into 1.0 × 106 gene-targeted patient iPSCs ...
-
bioRxiv - Molecular Biology 2019Quote: ... and RPA 2 and 3 were cloned into 11A vectors (Addgene: 48294), followed by assembly of all RPA subunits into one vector by successive ligation independent cloning reactions ...
-
bioRxiv - Neuroscience 2021Quote: pAAV-CaMKIIa-eGFP (titer ≥ 3×1012 vg/mL, Addgene, catalog # 50469-AAV5) and pAAV5-CaMKII-hChR2(H134R)-eYFP-WPRE (titer ≥ 1×1013 vg/mL ...
-
bioRxiv - Neuroscience 2019Quote: ... which were inserted into pDD162 (Peft-3::Cas9 + Empty sgRNA; Addgene #47549), respectively ...