Labshake search
Citations for Addgene :
51 - 100 of 1893 citations for 6 N CARBETHOXY 3 CHLORO 7 8 DIHYDRO 5H PYRIDO 4 3 C PYRIDAZINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Linear ubiquitination at damaged lysosomes induces local NF-κB activation and controls cell survivalbioRxiv - Cell Biology 2023Quote: ... GFP as non-human target (NHT) control (5’-GGAGCGCACCATCTTCTTCA-3’, 5’-GCCACAAGTTCAGCGTGTC-3’, and 5’-GGGCGAGGAGCTGTTCACCG-3’) cloned into pLentiCRISPRv2 (Addgene, 52961, deposited by Feng Zhang). To generate lentiviral particles ...
-
bioRxiv - Biophysics 2020Quote: ... containing N-terminal 6-His-WT-p53 (1-303) (Addgene, 24859), was used to express p53 ...
-
bioRxiv - Microbiology 2021Quote: ... 4-363h21C1 and 3-978h1C1 and were cloned into lentiviral vector pLKO.1-puro (Addgene, catalogue #8543). Lentiviral vectors were produced in 293T cells by Fugene transfection and the supernatant was used to infect Jurkat cells ...
-
bioRxiv - Neuroscience 2022Quote: ... A pcDNA3 flag HA 14-3-3 β plasmid was a gift from William Sellers (Addgene plasmid # 8999 ...
-
bioRxiv - Cell Biology 2023Quote: ... and let-858 3’ UTR and mKate::HA::let-858 3’UTR from pDD287 (Addgene #70685). Correct sequences of constructed plasmids were confirmed with Sanger sequencing ...
-
bioRxiv - Cell Biology 2022Quote: ... U2OS 2-6-3 were transduced with pLenti CMV rtTA3 Blast (w756-1, plasmid #26429; Addgene, gift from E. Campeau) for the expression of rtTA ...
-
bioRxiv - Biophysics 2022Quote: ... The plasmid MApple-LC-Myosin-N-7 was a gift from Michael Davidson (Addgene plasmid 54920 ...
-
bioRxiv - Biophysics 2020Quote: ... The plasmid MApple-LC-Myosin-N-7 was a gift from Michael Davidson (Addgene plasmid # 54920 ...
-
bioRxiv - Cell Biology 2023Quote: ... The plasmid MApple-LC-Myosin-N-7 was a gift from Michael Davidson (Addgene plasmid 54920 ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’-GGG GGG GGC GGA ATT CTC AGT CTA TCT TTT CTT TCT GGA CCA GTC TGG GAG C-3’ and pmScarlet-C1 (gift from Dorus Gadella; Addgene plasmid # 85042; http://n2t.net/addgene:85042; RRID:Addgene_85042) and GFP-TM(SAC1 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... pKB12 was constructed by replacing the LEU2 auxotrophic cassette of pDEST-DHFR F[3]-C (LEU2) (Addgene #177796) (Marchant et al ...
-
bioRxiv - Molecular Biology 2024Quote: ... CASFx-1 (RBFOX1N-dCasRx-C) and CASFx-3 (dCasRx-RBM38) were obtained from Addgene (Plasmid #118635 and #118638). RBFOX1N-dPspCas13b-C was constructed previously 13 ...
-
bioRxiv - Cell Biology 2019Quote: ... HA-14-3-3σ (11946, Addgene) was transfected into skin keratinocytes in primary culture using the P1 Primary Cell 4D-Nucleofector™ X Kit (V4XP-1024 ...
-
bioRxiv - Bioengineering 2022Quote: ... 3 μg pMD2.G (Addgene #12259), 12 μg pCMV delta R8.2 (Addgene #12263) ...
-
bioRxiv - Cell Biology 2021Quote: ... mEmerald-ER-3 (Addgene plasmid #54082), and calnexin-mEmerlad (Addgene plasmid #54021 ...
-
bioRxiv - Cell Biology 2021Quote: ... and 3 μg pMD2.G (Addgene) were transfected into 293T cells at 80% confluency in a 10-cm dish with 8 ml of media ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 μg psPax vector (Addgene #12260), 1.5 μg pMD2.G vector (Addgene #12259 ...
-
bioRxiv - Cell Biology 2021Quote: ... or Galectin-3-GFP (Addgene; [48]). The bacterial expression vector pZsGreen (Takara Bio USA ...
-
bioRxiv - Cell Biology 2021Quote: ... pCFJ104 (Pmyo-3::mCherry, Addgene #19328) and pGH8 (Prab-3::mCherry ...
-
bioRxiv - Bioengineering 2021Quote: ... 3 µg pMD2.G (Addgene #12259) and 9 µg lentiviral vector were diluted in 1.2 mL OptiMEM ...
-
bioRxiv - Developmental Biology 2021Quote: ... U6-1 and U6-3 (Addgene plasmid #83954 ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 3 μg psPAX2 (Addgene #12260) using Lipofectamine 3000 (Life Technologies ...
-
bioRxiv - Cell Biology 2024Quote: ... and 3 μg psPAX2 (AddGene 12260) using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Biochemistry 2023Quote: ... mCherry-ER-3 (Addgene, Watertown, MA), or Perilipin1-YFP[41] following established protocols[32] ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3 µg of psPAX2 (Addgene #12260), and 1.5 µg of the pMD2.G plasmid (Addgene #12259 ...
-
bioRxiv - Neuroscience 2023Quote: ... For transfection, 5 µg of DNA (4:3:1 of a transgene, pCMVdR8.74 (packaging plasmid; Addgene, Plasmid #22036) and pMD2.G (envelope plasmid ...
-
bioRxiv - Cell Biology 2022Quote: ... annealed oligo (5’-CACCGATGACCAACGACGCAAGTTT-3’ and 5’-AAACAAACTTGCGTCGTTGGTCATC-3’) was inserted into PX459 (pSpCas9(BB)-2A-PuroV2.0) (Addgene) (Ran et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... The entire coding sequence of GCaMP6s was amplified by PCR with primers 5’–GGATCCGCCACCATGGGTTCTCATCATCATCA–3’ and 5’–GTAGCCGAACCGGTCTTCGCTGTCATCATTTGTAC–3’ using pGP-CMV-GCaMP6s (Addgene plasmid # 40753; http://n2t.net/addgene:40753; RRID:Addgene_40753) as a template ...
-
bioRxiv - Neuroscience 2020Quote: ... Lin Tian)56 using Q5 polymerase (primers: 5’-aaaagctagcatgaagacgatcatcgccctgagc-3’ and 5’-aaaaaggcgcgcctcaggttgggtgctgaccg-3’) and subcloned into pAAV.CBA.DIO (Addgene #81008)108 backbone between AscI and NheI restriction sites ...
-
bioRxiv - Biochemistry 2022Quote: ... The wild-type 14-3-3 ζ gene was cloned into NcoI/XhoI digested pBAD plasmid (Addgene #85482) with a TEV cleavable C-terminal His6 purification tag ...
-
bioRxiv - Molecular Biology 2023Quote: gRNAs targeting LSM14A (5’-TCTGTACCAAAGGATCGAAC-3’) and XRN1 (5’-AGAGAAGAAGTTCGATTTGG-3’) were cloned into LentiCRISPR v2 (Addgene #52961) using BsmBI restriction enzyme sites and confirmed by sequencing ...
-
bioRxiv - Genomics 2020Quote: ... pCFJ104 - Pmyo-3∷mCherry∷unc-54 (Addgene plasmid # 19328 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 3 μg psPAX2 (packaging plasmid; Addgene) was performed using iN-fect (Intron Biotechnology ...
-
bioRxiv - Cell Biology 2021Quote: ... and pGH8 (Prab-3::mCherry, Addgene #19359) (Frøkjaer-Jensen et al. ...
-
bioRxiv - Genomics 2022Quote: ... and 3 μg pMD2.G (Addgene, #12259) into 293T cells cultured in 100 mm dish ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 μg of pGW-PervevalHR (Addgene #57432) (22) ...
-
bioRxiv - Immunology 2021Quote: ... myc (pCSF107mT-GATEWAY-3’-Myc tag, Addgene), green fluorescence protein (GFP ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 3 μg of pVSVg (8454; Addgene); FuGENE HD transfection reagent (Promega ...
-
bioRxiv - Genetics 2022Quote: ... Tc’hsp5’-Gal4Delta-3’UTR] (Addgene plasmid # 86449) was used as a donor plasmid with Piggybac insertion repeats and the 3xP3::EGFP reporter (Schinko et al. ...
-
bioRxiv - Physiology 2023Quote: ... and mPlum-mito-3 (Addgene plasmid #55988) using Fugene6 (Promega Inc. ...
-
bioRxiv - Neuroscience 2022Quote: ... +0.4 ML with diluted (1:3; Addgene) 4 × 0.15 μL of AAV9-Synapsin-jGCaMP7f-WPRE (Addgene) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... MAFA in pX330S-3 (Plasmid #58779, Addgene), Insulin in pX330S-4 (Plasmid #58780 ...
-
bioRxiv - Genomics 2023Quote: ... with 3 μg of psPAX (Addgene, 12260) and 1 μg of pMD2.G (Addgene ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’-GGG GGG GGC GGA ATT CTC AGT CTA TCT TTT CTT TCT GGA CCA GTC TGG GAG C-3’ and pmScarlet-C1 (gift from Dorus Gadella; Addgene plasmid # 85042 ...
-
bioRxiv - Immunology 2021Quote: ... Full length FOXN1 cDNA without a stop codon was cloned into vector backbones positioning at its C-terminus either a flag (pCSF107mT-GATEWAY-3’-FLAG, Addgene), myc (pCSF107mT-GATEWAY-3’-Myc tag ...
-
bioRxiv - Genetics 2019Quote: ... Only a single site upstream of the c(3)GccΔ1 deletion was selected (AAAGCTTTGTTGGCCTGTATTGG) and constructed into the pU6-BbsI-chiRNA guide RNA (gRNA) plasmid (Addgene 45946). Sense (CTTCGAAAGCTTTGTTGGCCTCTAT ...
-
bioRxiv - Genetics 2019Quote: ... and guide 2 c(3)GccΔ3: TCTTGAACAACAATCTGTCAAGG) and constructed into the pU6-BbsI-chiRNA guide RNA (gRNA) plasmid (Addgene 45946). Sense and antisense oligonucleotides (guide 1 c(3)GccΔ2 ...
-
bioRxiv - Cell Biology 2020Quote: ... 25 ng/µl of co-injection marker pCFJ104 (Pmyo-3:mCherry:unc-54 3’UTR, a gift from Erik Jorgensen, Addgene plasmid #19328 ...
-
bioRxiv - Neuroscience 2022Quote: ... The cDNA of Ncam2.1 was amplified from the pCNcam2.1 with 5’-ACCATGAGCCTCCTCCTCTCC-3’ and 5’-CTGACCAAGGTGCTGAAACT-3’and cloned into pWPI (Plasmid #12254, Addgene) within PmeI site to obtain the pWPI-NCAM2.1 ...
-
bioRxiv - Neuroscience 2022Quote: ... The cDNA of Ncam2.2 was amplified with 5’-ACCATGAGCCTCCTCCTCTCC-3’ and 5’-TCTCTGATCAGGGAGTACCA-3’ and cloned into pWPI (Plasmid #12254, Addgene) within PmeI site to obtain the pWPI-NCAM2.2.