Labshake search
Citations for Addgene :
351 - 400 of 2747 citations for 6 Isoquinolinol 1 2 3 4 tetrahydro 1 4 methylphenyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... Nsp1-NT (1-127 aa) and Nsp1-CT (128-180 aa) were amplified from pDONR207 SARS-CoV-2 NSP1 (Addgene) by PCR and then cloned into pDB-His-MBP or BacMam pCMV-Dest plasmid ...
-
bioRxiv - Bioengineering 2022Quote: ... sgRNA cassette) were PCR-amplified and recloned into 2 lentiviral plasmids (pLKO.1 neo, Addgene #13425; pLJM-EGFP, Addgene #19319) and ...
-
bioRxiv - Neuroscience 2020Quote: ... injections of rAAV2-retro-Cre (produced by Salk Vector Core or Vigene, 2×1012 to 1×1013 viral genomes/ml, produced with capsid from Addgene plasmid #81070 packaging pAAV-EF1a-Cre from Addgene plasmid #55636 ...
-
bioRxiv - Microbiology 2021Quote: Individual sgRNAs (sgLRRC15 #1: GACATGCAGGCACTGCACTG; sgLRRC15 #2: AGTGTCAGCCCGGGACATGC; sgACE2: GTTACATATCTGTCCTCTCC) targeting the candidate genes were cloned into linearized pXPR_502 (Addgene, #96923) for CRISPR activation ...
-
bioRxiv - Cell Biology 2022Quote: ... talin 2 shRNA-stable cells were co-transfected with Tln1 siRNA and EGFP-talin 1 head (Addgene plasmid no. 32856) or EGFP-talin 1 L325R (the mutant version ...
-
bioRxiv - Immunology 2020Quote: ... with lentiviral packaging vectors pCAG-eco and psPAX.2 plus empty pLKO.1 control (EV) with a puromycin selection cassette (all obtained from Addgene) or a shRNA containing pLKO.1 targeting DGAT1 (GE Dharmacon CAT# RMM4534-EG13350 - TRCN0000124791) ...
-
bioRxiv - Neuroscience 2020Quote: ... The loxP-NeoR-loxP cassette was inserted at the MluI site in the intron between exons 1 and 2 following PCR amplification from pL452 (Addgene) using primers 3-For and 3-Rev ...
-
bioRxiv - Immunology 2022Quote: ... with lentiviral packaging vectors pCAG-eco and psPAX.2 plus empty pLKO.1 control (EV) with a puromycin selection cassette (all obtained from Addgene) or a shRNA containing pLKO.1 targeting Cpt1a (GE Dharmacon CAT# RMM3981-201819967 – TRCN0000110596 ...
-
bioRxiv - Cell Biology 2022Quote: ... was constructed by recombining pENTR1a emGFP-Slc37a2 iso 2 with the pLenti PGK Hygro DEST (w530-1) vector (a gift from Eric Campeau and Paul Kaufman, Addgene plasmid # 19066 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Nsp1-NT (1-127 aa) and Nsp1-CT (128-180 aa) were amplified from pDONR207 SARS-CoV-2 NSP1 (Addgene) by PCR and then cloned into pDB-His-MBP or BacMam pCMV-Dest plasmid ...
-
bioRxiv - Neuroscience 2023Quote: ... injections of rAAV2-retro-Cre (produced by Salk Vector Core or Vigene, 2×1012 to 1×1013 viral genomes/ml, produced with capsid from Addgene plasmid #81070 packaging pAAV-EF1a-Cre from Addgene plasmid #55636 ...
-
bioRxiv - Cell Biology 2024Quote: ... we received plasmids encoding WT SARS-CoV-2 SP (Wuhan-Hu-1) and its receptor binding domain (RBD) from Addgene under a Material Transfer Agreement ...
-
bioRxiv - Cancer Biology 2024Quote: ... sgRNA oligonucleotides purchased from IDT were annealed and ligated in the BbsI restriction site of pX330A-1×2 (Addgene, #58766) plasmid to make pX330A-1x2-cNAT10 vector ...
-
bioRxiv - Cell Biology 2021Quote: ... For CRISPR Cas9 KO generation two gRNA directed to exon 4 and exon 5 (Table M1) were cloned in pSpCas9 (BB)-2A-Puro V2.0 (Addgene #62988).
-
bioRxiv - Molecular Biology 2021Quote: ... targeting a coding sequence of exon 4 in SETX was inserted into the BbsI site of pX330 (plasmid 42230, Addgene) as described (103 ...
-
bioRxiv - Neuroscience 2020Quote: ... SOM and PKCδ Cre mice were injected with 300 nl of AAV8.hSyn Pr.DIO.hM3Dq-mCherry (≥ 4×1O12 vg/mL; Addgene #44361-AAV8) or AAV9.hSyn Pr.DIO.hM4Di-mCherry (≥ 1×1013 vg/mL ...
-
bioRxiv - Bioengineering 2022Quote: ... we generated one plasmid harboring 4 distinct sgRNAs targeting the promoter region of AaRel1 (AAEL007696, OA-1127B, Addgene plasmid #190997). Firstly ...
-
bioRxiv - Cell Biology 2023Quote: ... they were electroporated with Yamanaka’s plasmids (plasmid numbers 27078 (human SOX2 and KLF4), 27080 (human L-MYC, LIN28), 27077 (human OCT3/4, shRNA against TP53) from Addgene, www.addgene.org ...
-
bioRxiv - Cancer Biology 2023Quote: ... They were then transduced with lentivirus containing the plasmid pLenti_CMV_GFP_Hygro [pLenti CMV GFP Hygro (656-4) was a gift from Eric Campeau & Paul Kaufman (Addgene viral prep # 17446-LV; RRID: Addgene_17446)] at a multiplicity of infection of 10 with 8 μg/mL polybrene (hexadimethrine bromide [Cat # 107689 ...
-
bioRxiv - Neuroscience 2023Quote: Th-cre rats were randomly assigned to a viral group and infused bilaterally with a cre-dependent AAV encoding either ArchT (N = 5; 4 males; AAV5-CAG-FLEX-ArchT-tdTomato, Addgene) or a tdTomato fluorescent protein control (tdTomato ...
-
bioRxiv - Neuroscience 2023Quote: Th-cre rats were randomly assigned to a viral group and infused bilaterally with a cre-dependent AAV encoding either ArchT (N = 7; 4 males; AAV5-CAG-FLEX-ArchT-tdTomato, Addgene) or a tdTomato fluorescent protein control (tdTomato ...
-
bioRxiv - Cell Biology 2021Quote: ... pLKO.1 (Addgene plasmid 8453 ...
-
bioRxiv - Neuroscience 2021Quote: ... a 1:1 mixture of AAV9-hSyn-Cre (1:40000 dilution, Addgene: 105553-AAV9, titer: 3.3×1013vg/ml) and AAV1-Syn-FLEX-GCaMP6s (Addgene ...
-
bioRxiv - Neuroscience 2021Quote: ... The two fragments (5’ homology arm and 3’ homology arm) were assembled into plasmid pBS-KS-attB1-2-PT-SA-SD-0-2xTY1-V5 (Addgene) that was linearized with XbaI and HindIII using In Fusion cloning ...
-
bioRxiv - Molecular Biology 2019Quote: cDNA from Source BioSicence clone C130076G01 was amplified with PCR adding restriction sites for NheI at 5’ end and AgeI at 3’ end (Supplementary Table 2) and cloned into pLIX_402 vector (a gift from David Root, Addgene #41394) using restriction ligation ...
-
bioRxiv - Biochemistry 2022Quote: Expression plasmid (pGEX-5X-3-SARS-CoV-2-3CL) was a gift from Alejandro Chavez & David Ho & Sho Iketani (Addgene plasmid # 168457 ...
-
bioRxiv - Genetics 2019Quote: ... and guide 2 c(3)GccΔ3: TCTTGAACAACAATCTGTCAAGG) and constructed into the pU6-BbsI-chiRNA guide RNA (gRNA) plasmid (Addgene 45946). Sense and antisense oligonucleotides (guide 1 c(3)GccΔ2 ...
-
bioRxiv - Microbiology 2021Quote: ... A gRNA sequence 5’-GGATGGGATCTTGGCGCACG-3’ targeting intronic sequence immediately prior to Exon 2 of Ace2 was cloned into the eSpCas9(1.1) plasmid (Addgene 71814). A targeting construct was designed to insert by homologous recombination the human ACE2 cDNA followed by a floxed WPRE-SV40 polyA and FRT-ed neomycin resistance cassette directly after the ATG-start codon of mouse Ace2 in exon 2 ...
-
bioRxiv - Genomics 2021Quote: ... iPSCs were transfected with pRT43 containing DHFR-dCas9-VPH and TALENS targeting the human CLYBL intragenic safe harbor locus (between exons 2 and 3) (pZT-C13-R1 and pZT- C13-L1, gifts from Jizhong Zou (Addgene plasmid # 62196 ...
-
bioRxiv - Neuroscience 2021Quote: Cultured Cdh11 wild-type and knockout hippocampal neurons (300,000 cells/2 cm2) were transfected at 3 DIV or 9 DIV with the pLL3.7-GFP vector (Addgene Cat#11795) using Lipofectamine 2000 (Invitrogen Cat#11668-019 ...
-
bioRxiv - Bioengineering 2023Quote: ... OCI-AML-2 and OCI-AML-3) were retrovirally transduced with MI-Luciferase-IRES-mCherry (gift from Xiaoping Sun, Addgene plasmid #75020 ...
-
bioRxiv - Neuroscience 2022Quote: ... 0.7-1 μL of virus (AAV2-CMV-mCreb, 1×1012 Addgene Plasmid #68551 ...
-
bioRxiv - Neuroscience 2020Quote: ... AAVrg-pCAG-FLEX-tdTomato-WPRE (Titer ≥ 1×1013 vg.mL−1, Addgene), CAV-2 Cre (Titer ≥ 2.5×1011 pp ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1-160 and 1-220 were cloned in pEBG-GST (Addgene). The vector expressing eGFP was described previously (49) ...
-
bioRxiv - Neuroscience 2024Quote: ... were injected a 1:1 mixture of pAAV.Syn.GCaMP6f.WPRE.SV40 (Addgene, stock #100837) virus and pAAV.CAG.LSL.tdTomato (Addgene ...
-
bioRxiv - Biophysics 2022Quote: ... NCBI Accession YP_009820873.1) were cloned with an N-terminal TEV protease-cleavable His6-tag using UC Berkeley Macrolab vector 2-BT (Addgene #29666). Truncations and other modified constructs were cloned by PCR mutagenesis and isothermal assembly ...
-
bioRxiv - Cell Biology 2019Quote: ... Two gRNA sequences targeting different regions of linc00899 (guide 1 and 2) were cloned into pU6-sgRNA EF1Alpha-puro-T2A-BFP (Addgene, #60955). All clones were verified by Sanger sequencing using mU6 forward primers (Supplementary Methods) ...
-
bioRxiv - Cancer Biology 2020Quote: ... a sox10 minimal promoter was PCR amplified from genomic DNA from AB* larvae with primers (Table 1 and 2) containing overlapping nucleotides to sequences on either side of the AgeI site in pENTR-EGFP2 (Addgene #22450), similarly described in (Quillien et al. ...
-
bioRxiv - Neuroscience 2021Quote: Voltron2 and Channelrhodopsin2 were expressed throughout the motor cortex using injections of a mixture of (1) rAAVretro-hSyn-Cre-WPRE (2×109 g.c.; Addgene #105553-AAVrg), (2 ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 S / HIV-1 pseudotyped viruses were packaged by co-transfecting a lentiviral construct pHIV-Luciferase (Addgene plasmid # 21375), a packaging construct psPAX2 (Addgene plasmid # 12260 ...
-
bioRxiv - Plant Biology 2023Quote: ... All four Level 1 cassettes were assembled in a one-step reaction into the Level 2 acceptor plasmid (pAGM4723 Addgene #48015) as previously described (Dudley et al. ...
-
bioRxiv - Immunology 2023Quote: Pseudovirus expressing Wuhan-Hu-1 SARS-CoV-2 S protein were produced by co-transfection of plasmids encoding a GFP protein (Addgene, 11619), a lentivirus backbone (VRC5602 ...
-
bioRxiv - Neuroscience 2023Quote: ... transfection mix for each plasmid was prepared in the following manner: 1 µg of transfer plasmid and 2 µg of second-generation packaging DNA mix containing psPAX (Addgene #12260) and pMD2.G (Addgene #12259 ...
-
bioRxiv - Microbiology 2023Quote: ... HUDEP-2 were transduced at an MOI <1 with lentivirus prepared from pXPR_101 (lentiCas9-blast, gift from Feng Zhang, Addgene plasmid 52962) and selected with blasticidin ...
-
bioRxiv - Cell Biology 2024Quote: ... The HTR8 cells with mir-218 KO were generated by cloning gRNAs that target mir-218-1 and mir-218-2 into a CRISPR/Cas9 vector PX459 (Addgene #62988). The plasmid was verified by sequencing ...
-
bioRxiv - Neuroscience 2022Quote: ... 90ul cells suspension containing 1M cells was mixed with 10 uL DNA mix: 4 ug pSpCas9(BB)-2A-Puro (PX459) plasmid (Addgene #48139), • 0.4 ug gRNA encoding plasmid (pKLV-U6gRNA(BbsI)-PGKzeo2ABFP ...
-
bioRxiv - Immunology 2019Quote: ... or VPR WT or a Q65R VPR mutant were produced through co-transfection of 293T cells with 4 plasmids coding for Gag/Pol (Addgene #12251), Rev (Addgene #12253) ...
-
bioRxiv - Molecular Biology 2021Quote: We performed a genome-wide CRISPR knock-out (KO) screen using the lentiviral Brie sgRNA library comprising 4 sgRNAs per protein-coding gene (Addgene #73632) (Doench et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... the fibroblasts were reprogrammed using the three plasmids (pCXLE-hOct3/4 [Addgene #27076], pCXLE-hSK [Addgene #27078], pCXLE-hUL [Addgene #27080]) with 10ug of each plasmid through the Amaxa Nucleofector (Lonza) ...
-
bioRxiv - Neuroscience 2020Quote: ... the fibroblasts were reprogrammed using the three plasmids (pCXLE-hOct3/4 [Addgene #27076], pCXLE-hSK [Addgene #27078], pCXLE-hUL [Addgene #27080]) with 10ug of each plasmid through the Amaxa Nucleofector (Lonza) ...