Labshake search
Citations for Addgene :
201 - 250 of 2747 citations for 6 Isoquinolinol 1 2 3 4 tetrahydro 1 4 methylphenyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... All 3 of the 6 wells were transfected with 100 ng of pCAG-NLS-HA-Bxb1 (Addgene #51271) and 1,500 ng of donor attB library whereas the T25 was transfected with 1,000 ng of the Bxb1 containing plasmid and 5,000 ng attB library ...
-
bioRxiv - Cell Biology 2021Quote: ... gonads of young adult BOX428 animals were microinjected with 30 ng/μl Pelt-2::αGFP-NB::ZIF-1 and 2.5 ng/μl Pmyo-2::GFP (#Addgene 26347) as a co-injection marker ...
-
bioRxiv - Cancer Biology 2023Quote: ... shRNA 2 (shYAP1 #2) or scramble shRNA (shNC) were inserted into pLKO.1-TRC Cloning Vector (Addgene, 10878, RRID: Addgene_10878) following the manufacturer’s protocol and sequenced ...
-
bioRxiv - Cancer Biology 2023Quote: ... shRNA 2 (shYAP1 #2) or scramble shRNA (shNC) were inserted into pLKO.1-TRC Cloning Vector (Addgene, 10878, RRID: Addgene_10878) following the manufacturer’s protocol and sequenced ...
-
bioRxiv - Immunology 2020Quote: ... the lentiCas9-v2 lentivirus were produced from HEK-293FT cells transfected with the lentiCas9-v2 plasmid mixed at a 2:1:1 DNA ratio of the lentiviral packaging plasmids pMD2.G (Addgene plasmid #12259) and psPAX2 (Addgene plasmid #12260 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Topbp1 (shTopbp1 #1 and shTopbp1 #2) and a scramble control sequence (shScbl) were cloned into the pLKO.1-Hygro lentiviral vector (Addgene plasmid #24150). The lentiviral-containing medium was harvested from HEK293T cells at 48 h and 72 h after transfection ...
-
bioRxiv - Microbiology 2023Quote: 4e5 VeroE6 cells were plated in 6-well plates and transfected with 1 μg VSV-G plasmid (Addgene #8454) via TransIT-X2 (Mirus) ...
-
bioRxiv - Cell Biology 2023Quote: ... we cloned human OPTN cDNA in a pETDuet-1 vector with an N-terminal 6×His tag followed by a TEV cleavage site (RRID:Addgene_190191). After the transformation of the pETDuet-1 vector encoding 6×His-TEV-mCherry-OPTN in E ...
-
bioRxiv - Cell Biology 2023Quote: ... we cloned human NDP52 cDNA in a pETDuet-1 vector with an N-terminal 6×His tag followed by a TEV cleavage site (RRID:Addgene_187829). After the transformation of the pETDuet-1 vector encoding 6×His-TEV-mCherry-NDP52 in E ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2×106 mEF-depleted cells were transfected with sgRNAs 2+3 and pCas9_GFP (a gift from Kiran Musunuru, Addgene #44719). To generate Chaserrb/b mESCs ...
-
bioRxiv - Cancer Biology 2019Quote: ... A mixture of 3 transfection plasmids were produced by combining 2 µg pMDG.2 (Addgene #12259) (Addgene, Watertown, Massachusetts, USA); 4 µg of pCMV delta R8.2 (Addgene #12263 ...
-
bioRxiv - Neuroscience 2021Quote: ... and pCXLE-hOCT3/4-shp53-F (Addgene plasmid #27077; http://n2t.net/addgene:27077;RRID:Addgene_27077) [pCXLE-hUL ...
-
bioRxiv - Genetics 2021Quote: We digested the human STARR-seq screening vector (hSTARR-seq_SCP1 vector_blocking 4, Addgene #99319) with both Thermo SgrDI and BshTI (AgeI ...
-
bioRxiv - Cell Biology 2020Quote: HA-NFAT1(4-460)-GFP was a gift from Anjana Rao (Addgene plasmid # 11107). Patterned cells expressing NFAT-GFP was imaged using Zeiss LSM 880 ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV1-phSyn1(S)-FLEX-TdTomato-T2A-Syp-EGFP (Addgene #51509, 4 x 1014GC/mL) was injected (60nL at 20nL/min ...
-
bioRxiv - Physiology 2022Quote: ... or scramble short hairpin RNA (shRNA) (Table 3) was inserted into the plasmid pLKO.1 (8453; Addgene). pSF-lenti or pLKO.1 together with the two helper plasmids psPAX2 (Addgene plasmid 12260 ...
-
bioRxiv - Cancer Biology 2023Quote: ... AAACTCGGAGTTCTCAGAGCCCAGC NFKB2 guide #1 F: CACCGTGGCCCCTACCTGGTGATCG NFKB2 guide #1 R: AAACCGATCACCAGGTAGGGGCCAC NFKB2 guide #2 F: CACCGCTTTCGGCCCTTCTCACTGG NFKB2 guide #2 R: AAACCCAGTGAGAAGGGCCGAAAGC pLKO.TRC (Addgene; Cat#10878) was used for generating shNMNAT1 KD in U-87 MG and U-251 MG cell lines ...
-
bioRxiv - Developmental Biology 2023Quote: ... sgRNAs 5’-CCCCATGGACATACCCACTG-3’ and 5’-CCAGTCGAGCAGAAAAGTGT-3’ defining a 244 bp region in Nodal exon 2 were cloned into pX458 (Addgene plasmid #48138) or pX459 (Addgene plasmid #48139 ...
-
bioRxiv - Cancer Biology 2020Quote: ... to co-transfect pBABE-puro or pBABE-puro.SLX4IP.3xFLAG with pCMV-VSV-G (at a ratio of 6:1, Addgene#8454) into GP2-293 cells (Clontech) ...
-
bioRxiv - Bioengineering 2020Quote: ... 400,000 HEK cells were seeded in 6-well plates and the next day transfected with 1 μg psPAX2 (Addgene #12260), 3 μg pCMV-VSV.G (Addgene ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were transfected with a 6:1 ratio of a firefly luciferase reporter plasmid driven by a pGL3-RARE-responsive promoter (Addgene) and a Renilla luciferase reporter plasmid driven by a constitutive CMV promoter (Promega) ...
-
bioRxiv - Neuroscience 2022Quote: ... 6 mice from each line were injected bilaterally with a pAAV9-CAG-Flex.GCaMP6s.WPRE.SV40 virus (Addgene, titre ≥ 1×1013 vg/mL) in the medial NAc shell (D1-cre and D2(A2a)-cre mice ...
-
bioRxiv - Developmental Biology 2023Quote: ... expressing a dominant negative variant of the rol-6 gene and an empty vector pSK (up to 200 ng μl-1 of DNA) (Addgene) using standard methods (42) ...
-
bioRxiv - Biochemistry 2021Quote: ... elegans ERH-2 (NCBI gene ID: 185323) was cloned into pET28a (Addgene: 69864-3), containing an N-terminal His6 tag followed by a TEV protease cleavage site (MGSSHHHHHHSSGENLYFQGHMAS ...
-
bioRxiv - Genomics 2019Quote: ... Each sequence was then transferred to the pMW#2 and pMW#3 vectors (Addgene) using the LR Clonase II (ThermoFisher) ...
-
bioRxiv - Neuroscience 2024Quote: ... postnatal 2-3 months) were injected bilaterally with pAAV-CaMKIIa-hM4D(Gi)-mCherry (Addgene: AAV8 ...
-
bioRxiv - Cell Biology 2021Quote: ... 0.25 μL of F-ABM lentiviral mix (1:1:1:1 of Addgene plasmids 27150 ...
-
bioRxiv - Neuroscience 2019Quote: A 60 nl viral mix containing a 3:1 ratio of AAV2retro-Cre (AAVrg-pmSyn1-EBFP-cre, Addgene) and AAV2-GFP (UNC viral core ...
-
bioRxiv - Cell Biology 2020Quote: ... was generated by ligating oligonucleotides containing the targeting sequence 5’-CAGTTCCTGGGTGGAGCTA-3’ into pLKO.1-puro (Addgene # 8453). The mitochondrial (CMV-mitoCAR-GECO1 ...
-
bioRxiv - Molecular Biology 2024Quote: ... CASFx-1 (RBFOX1N-dCasRx-C) and CASFx-3 (dCasRx-RBM38) were obtained from Addgene (Plasmid #118635 and #118638). RBFOX1N-dPspCas13b-C was constructed previously 13 ...
-
bioRxiv - Neuroscience 2023Quote: ... Suppl Fig 3: AAV9-CaMKIIa-hChR2-EYFP (1:5, Addgene viral prep #26969- AAV9; http://n2t.net.addgene:26969; RRID; Addgene:26969 ...
-
bioRxiv - Biochemistry 2023Quote: ... coli BL21 (DE3) cells using the plasmid pRSFDuet-1/CylLL/CylM-2 (Addgene ID #208759), following the method previously reported.9 For the preparation of lanthionine standard ...
-
bioRxiv - Biochemistry 2024Quote: ... two all-in-one CRISPR-Cas9 vectors were generated from pX330A-1×2 (58766, Addgene) and pX330S-2-PITCh (63670 ...
-
bioRxiv - Neuroscience 2021Quote: ... pAAV5-hSyn-dLigh1.2 (titer ≥ 4×1012 vg/ml) was a gift from Lin Tian (Addgene viral prep #111068-AAV5 ...
-
bioRxiv - Neuroscience 2019Quote: ... oligonucleotide pairs (Supplementary Table 4) were used for PCR and inserted into pCFD5 (Addgene #73914) via Gibson Assembly ...
-
bioRxiv - Neuroscience 2020Quote: ... DIV 4 neurons were transfected with pGP-CMV-GCaMP6f (a gift from Douglas Kim, Addgene plasmid # 40755 ...
-
bioRxiv - Cancer Biology 2022Quote: ... sgFIGNL1#4: CCTATACCCAAGCAAGATGG) were cloned into lentiCRISPRv2 (a gift from Feng Zhang, Addgene plasmid #52961) in a single-step digestion-ligation reaction (2 hours (h ...
-
bioRxiv - Neuroscience 2022Quote: [4] DsRed from pBac-DsRed-ORCO_9kbProm-QF2 (a gift from Christopher Potter, Addgene ID #104877) (Riabinina et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 x 105 cells from the previous transfection were transfected with pCMV-PEmax (Addgene: 174820)11 (800 ng ...
-
bioRxiv - Immunology 2021Quote: ... HEK293T cells were seeded in 6-well plates and the next day transfected with 1 μg psPAX2 packaging plasmid (Addgene 12260), 500 ng pMD2.G VSV-G envelope plasmid (Addgene 12259 ...
-
bioRxiv - Neuroscience 2020Quote: Stereotaxic injection of AAV-EF1a-DIO-HChR2(H134R)-eYFP (serotype 2/1 or 2/9, U. Penn Vector Core, Philadelphia, PA, USA or Addgene, Watertown, MA, USA) was performed in 6-8 weeks old DAT-IRES-Cre or FoxP2-Cre transgenic mice ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... encoding the Luc mRNA with the SARS-CoV-2 packaging signal in 3’-UTR (Addgene), were co-transfected with plasmids expressing the SARS-CoV-2 nucleocapsid (nCoV-2-N) ...
-
bioRxiv - Neuroscience 2020Quote: ... bilaterally injected using a pulled glass needle in the hippocampal area with 0.5 μL AAV-hSyn-Cre-EGFP at 3 × 1012 GC ml-1 (Addgene #105540 ...
-
bioRxiv - Bioengineering 2021Quote: ... rat TE-NSPs were incubated overnight at 5 DIV with media including 1/2000 of pAAV1.hSyn.eGFP.WPRE.bHG (final titer of ~3×1010 genomic copies/mL; Addgene, 105539-AAV1), with a full media change on the next day.
-
bioRxiv - Neuroscience 2021Quote: ... a 1:3 mixture of AAV1-CAG-mRuby3 (custom made from plasmid Addgene 107744, titer: 1.6×1012 vg/ml) and AAV1-Syn (or CAG)-FLEX-GCaMP6s (Addgene ...
-
bioRxiv - Cell Biology 2021Quote: To generate the nrfl-1(null) deletion allele a mix containing Peft-3::Cas9 (Addgene #46168; 50 ng/μl), two pairs of sgRNA plasmids targeting the 5’ or 3’ ends of the nrfl-1 open reading frame (75 ng/μl each) ...
-
bioRxiv - Immunology 2021Quote: ... HIV-1 dual reporter vector expressing mCherry and luciferase (NL4-3 mCherry Luciferase, plasmid#44965) was purchased from Addgene. Plasmid expression a C-terminally truncated SARS-CoV-2 S protein (pSARS-CoV-2Δ19 ...
-
bioRxiv - Genomics 2023Quote: ... Both gRNA (1 µg each) vectors were co-transfected with 3 µg of pCas9_GFP (a gift from Kiran Musunuru; Addgene plasmid #44719 ...
-
bioRxiv - Neuroscience 2022Quote: ... 2 µL of the adeno-associated viral vector rAAV9/1.EF1a.DIO.hChR2(H134R)-eYFP.WPRE.hGH (Addgene, #20298-AAV9) was dyed with 0.3 µL fast green (Sigma-Aldrich ...
-
bioRxiv - Genomics 2022Quote: ... 1-10 µg YAC/BAC payload DNA and 2-5 µg pCAG-iCre plasmid (Addgene #89573) per transfection ...