Labshake search
Citations for Addgene :
351 - 400 of 2889 citations for 5 Pyrimidinecarbonitrile 1 2R 2 3 dihydroxypropyl 1 2 3 4 tetrahydro 3 methyl 2 4 dioxo 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... 500 ml LB culture of pCDFDuet-1-6×His-SARS-CoV-2-NSP7/NSP8 (Addgene)-transformed E.coli BL21 DE3 strain was induced by isopropyl β-d-1-thiogalactopyranoside (IPTG ...
-
bioRxiv - Biochemistry 2023Quote: ... coli BL21 (DE3) cells using the plasmid pRSFDuet-1/CylLL/CylM-2 (Addgene ID #208759), following the method previously reported.9 For the preparation of lanthionine standard ...
-
bioRxiv - Biochemistry 2024Quote: ... two all-in-one CRISPR-Cas9 vectors were generated from pX330A-1×2 (58766, Addgene) and pX330S-2-PITCh (63670 ...
-
bioRxiv - Cell Biology 2020Quote: ... and the ER localization marker mCherry-ER-3 (Addgene: 55041) for 2 days ...
-
bioRxiv - Molecular Biology 2020Quote: ... mEmerald-ER-3 was a gift from Michael Davidson (Addgene plasmid # 54082 ...
-
bioRxiv - Genomics 2021Quote: ... 10 µg D8.9 and 3 µg pCMV-VSV-G (Addgene) packaging plasmids using Lipofectamine LTX with Plus Reagent (Thermo Fisher) ...
-
bioRxiv - Cell Biology 2021Quote: GFP-tagged galectin 3 (pEGFP-hGal3 (Addgene, plasmid no. 73080) was mutated using the Q5 site directed mutagenesis kit (New England Biolabs ...
-
bioRxiv - Neuroscience 2022Quote: ... and (3) mKok amplified from pCS2+ ChMermaid S188 (Addgene 53617) with the CAAX membrane tag sequence (Sutcliffe et al. ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 3 µg MSCV CreERT2 puro (Addgene, 2276 ref (18)) and polybrene (8 µg/mL ...
-
bioRxiv - Biochemistry 2020Quote: pHA#852: mec-4p∷FynY531F∷unc-54 3’UTR (Addgene ID ...
-
bioRxiv - Neuroscience 2021Quote: ... The 1208 bp rab-3 promoter sequence (Addgene Plasmid #110880) was inserted directly upstream of the N-terminal TOMM-20 coding region ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 3 μg pMD2.G (gift from Didier Trono, Addgene #12259), 12 μg of pCMV delta R8.2 (gift from Didier Trono ...
-
bioRxiv - Microbiology 2022Quote: ... were generated by annealing two primers ordered from IDT DNA and cloned using BbsI into pKSB-sgRNA (Addgene #173671—3) vectors containing the U6 snRNA polymerase III promoter (AGAP013557) ...
-
bioRxiv - Cancer Biology 2023Quote: Toronto Knockout Version 3 library was purchased from Addgene (#90294) (26) ...
-
MYB68 orchestrates cork differentiation by regulating stem cell proliferation and suberin depositionbioRxiv - Plant Biology 2024Quote: ... and 3) the P336-FBP_11 vector (Available from AddGene (#139702)) ...
-
bioRxiv - Cancer Biology 2021Quote: ... HT-1080N cells were transduced with lentiviruses carrying the reverse tetracycline-controlled transactivator 3 under a CMV promoter (CMV-rtTA3) (Cat# w756-1, Addgene). HT-1080N-rtTA3 cell lines were selected in 10 μg/mL blasticidin (Cat # A1113902 ...
-
bioRxiv - Cell Biology 2022Quote: The sgRNA oligomers for SLC25A46 targeting exon 1 and 3 were annealed and inserted into plasmid pSpCas9(BB)-2A-Puro (PX459) V2.0 from Addgene (62988) via combined ligation (T7 ligase NEB).
-
bioRxiv - Biophysics 2023Quote: Fusion constructs with pTREtight2 vectors were co-transfected with reverse tetracycline-controlled transactivator 3 (pLenti CMV rtTA3 Hygro (w785-1)) plasmid (Addgene) in the presence of doxycycline (Clontech) ...
-
bioRxiv - Cell Biology 2022Quote: ... Dynamin 2-mTFP1 (or dynamin 1-mTFP1) construct was created by replacing the EGFP tag of dynamin 2-EGFP (or dynamin 1-EGFP, Addgene) with mTFP1 (Addgene) ...
-
bioRxiv - Bioengineering 2022Quote: ... Each shRNA was cloned into the host pLKO.1-puro vector. PLKO-shFOXA1#1 (Cat. #: 70095) and PLKO-shFOXA1#2 (Cat. #: 70096) were obtained from Addgene, and previously used 45 ...
-
bioRxiv - Cell Biology 2023Quote: PARP-1 sgRNAs (#1, GTGGCCCACCTTCCAGAAGC; #2, ATACCAAAGAAGGGAGT-AGC) were synthesized and subcloned into lenti-CRISPR vector (Addgene, pXPR_001, plasmid 49535). Lentiviral vectors were co-transfected into HEK293FT cells with the lentivirus packaging plasmids pVSVg and psPAX2 using FuGENE® HD ...
-
bioRxiv - Biochemistry 2020Quote: An sgRNA targeting CDK12 (5’-GTGGACAAGTTTGACATTAT-3’) was cloned into the pSpCas9(BB)-2A-eGFP (PX458) vector (Addgene 48138). For CDK12 G731E/R knock-in ...
-
bioRxiv - Neuroscience 2020Quote: ... The βIII-spectrin target sequence (5’-GAGACCTGTACAGCGACCTG-3’) was inserted into pSpCas9(BB)-2A-GFP (PX458) (Addgene plasmid #48138) (Ran et al. ...
-
bioRxiv - Cell Biology 2019Quote: ... and Firefly Luciferase (5’-TGAAGTCTCTGATTAAGTA-3’) were cloned into the HpaI and XhoI restriction sites in pSICOR (Addgene RRID:Addgene_11579) (Ventura et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’-AAACGGGATGCAGGGATGTCGACTc-3’) and cloning this into the unique BbsI sites of pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene # 42230), modified by the addition of a PGK-Puro cassette.
-
bioRxiv - Plant Biology 2023Quote: ... and rbcS-E9 enhancers and their 169-bp 3′ and 5′ segments as well as the 35S enhancer were PCR amplified from pZS*11_4enh (Addgene no ...
-
bioRxiv - Cell Biology 2023Quote: ... JR20s were used to express Cas9 and sgRNA (5’-TCGACAGCCTTATGGCGGAC-3’) targeting mouse PFN1 25 from pLentiCRISPRv2 (Addgene #52961) by lentiviral transduction ...
-
bioRxiv - Cancer Biology 2020Quote: WM266-4 or SK-MEL-2 cells were co-transduced with conditioned media containing lentiviruses bearing Firefly luciferase-7TFP (Addgene #24308, β-catenin reporter) and Renilla luciferase pLenti.PGK.blast-Renilla Luciferase (Addgene #74444 ...
-
bioRxiv - Neuroscience 2022Quote: ... 2 µL of the adeno-associated viral vector rAAV9/1.EF1a.DIO.hChR2(H134R)-eYFP.WPRE.hGH (Addgene, #20298-AAV9) was dyed with 0.3 µL fast green (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2021Quote: ... and AAV.Syn.NES-jRGECO1a.WPRE.SV40 (Serotype 2/9; titer ≥ 1×1013 vg/mL) viruses were purchased from Addgene.
-
bioRxiv - Immunology 2021Quote: ... Guide 1 (TGTTGGGGAACATATGACAC) and Guide 2 (AAGGAAAAATTCAAACAAGG) sequences were cloned into lentiGuide-puro plasmid (Addgene, #52963), transformed in Stbl3 bacteria (Invitrogen ...
-
bioRxiv - Genetics 2023Quote: pHarvester was generated using pCFD5-gRNA#1&2 and pnos-Cas9-nos plasmids (Addgene no: 62208). Briefly ...
-
bioRxiv - Neuroscience 2023Quote: Heterozygous ChAT-Cre mice were bilaterally injected with 1.0 µL of pAAV.Syn.Flex.GCaMP6s.WPRE.SV40 (diluted 1:2 in dPBS; Addgene: 100845-AAV5) in basal forebrain (AP ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 µL of the adeno-associated viral vector rAAV9/1.EF1a.DIO.hChR2(H134R)-eYFP.WPRE.hGH (Addgene, #20298-AAV9) was dyed with 0.3 µL fast green (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2022Quote: ... The plasmid encoding 2×FKBP-GFP-Rab29 was generated by transferring 2×FKBP sequence from Addgene plasmid #20149 into Hind III site of pCMV10 plasmid followed by inserting EGFP-Rab29 sequence into Not I - Xho I site of pCMV10 ...
-
bioRxiv - Cell Biology 2022Quote: ... pcDNA3.1-SARS2-Spike (2) and pcDNA3.1-hACE2 (2) were obtained from Addgene (Addgene plasmids #145032; #145033); pCI-SARS2-Spike expressing a codon optimized version of the gene coding for S protein of SARS-CoV-2 was provided by Nicolas Escriou (Institut Pasteur) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Level 2 assembly was performed using the Level 2 acceptor pGoldenGreenGate-M (pGGG-M) (Addgene #165422) binary vector (Smedley et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... Level 2 assembly was performed using the Level 2 acceptor pGoldenGreenGate-M (pGGG-M) (Addgene #165422) binary vector (Smedley et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... we cloned the dgn-1 promoter and AcNPV p10 3’UTR into the vector pPD49.26 (from the Andrew Fire plasmid kit, Addgene Kit #1000000001) to generate plasmid pNTC2 ...
-
bioRxiv - Cell Biology 2022Quote: ... the PCR-amplified fragment of pie-1p::gfp::PH::pie-1 3’UTR was inserted into pCFJ1662 (a gift from Erik Jorgensen, Addgene #51482). Plasmid mixtures containing pCFJ1662_PH ...
-
bioRxiv - Cell Biology 2024Quote: Individual single-guide RNAs (sgRNAs) (sgBTN3A2 #1: TGTTCTCTCCCTTGGCGTTGCTCCACTGTA; sgBTN3A2 #3: ATCATGAGAGGCGGCTCCGGGGAGGGTGTATC) targeting the candidate gene were cloned into linearized lentiCRISPRv2 (#52961, Addgene, USA). Lipofectamine™ 3000 transfection reagent in Opti-MEM medium was used to co-transfect HEK293T cells with psPAX2 (#12260 ...
-
bioRxiv - Neuroscience 2021Quote: ... were added to each well along with 1 μl of Syn1-EBFP-Cre (serotype, 2-1; titer, 6×1012 genomes/mL; MOI, ∼8-0.08; Addgene, 51507-AAV1) delivered at full strength or diluted 1:103-104 ...
-
bioRxiv - Neuroscience 2023Quote: We used AAV1-hSyn-GCaMP6f (2 × 1013 vg/mL Penn Vector Core/Addgene; diluted 1:8 to 1:15 in saline) for experiments involving two-photon calcium imaging of V1 layer 2/3 cells ...
-
bioRxiv - Neuroscience 2024Quote: ... Pups were injected unilaterally with 1 μl of AAV9-hSyn-DIO-ChrimsonR-mRuby2-ST (2 × 1012 gc ml−1; Addgene #105448) or 1 μl of AAV9-CAG-Flex-ArchT (2 × 1012 gc ml−1 ...
-
bioRxiv - Neuroscience 2019Quote: ... into pPD132.102 (pmyo-2, #1662, Addgene) via restriction with BamHI and EcoRI ...
-
bioRxiv - Biochemistry 2020Quote: ... and 2) pEVOL-pBpF (Addgene #31190), which encodes a tRNA synthetase/tRNA pair for the in vivo incorporation p-benzoyl-l-phenylalanine (BPA ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 μg pCMV-VSVG (Addgene 8454), 2 μg pMDLg/pRRE (Addgene 12251) ...
-
bioRxiv - Cancer Biology 2021Quote: ... or lentiCRISPRv.2-hygro (Addgene 98291). Validation of guide specificity was assessed by Western blot of low-passage cells ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 μg pMDLg/pRRE (Addgene 12251), 2 μg pRSV-Rev (Addgene 12253) ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 μg pRSV-Rev (Addgene 12253), and 2 μg lentiviral plasmid carrying transgene (LeGO iG-CDK4R24C ...