Labshake search
Citations for Addgene :
601 - 650 of 2889 citations for 5 Pyrimidinecarbonitrile 1 2R 2 3 dihydroxypropyl 1 2 3 4 tetrahydro 3 methyl 2 4 dioxo 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: ... pCFJ104 - Pmyo-3∷mCherry∷unc-54 (Addgene plasmid # 19328; http://n2t.net/addgene:19328; RRID:Addgene_19328), and pMA122 - peel-1 negative selection (Addgene plasmid # 34873 ...
-
bioRxiv - Genomics 2020Quote: ... We then selected then 3 sgRNAs to be cloned into lentiGuide-Puro (52963, Addgene) as previously described95 ...
-
Therapeutic base and prime editing of COL7A1 mutations in recessive dystrophic epidermolysis bullosabioRxiv - Bioengineering 2021Quote: ... and 3’ extensions were annealed and cloned into pU6-pegRNA-GG-acceptor (Addgene #132777). The oligos are listed in Table S3.
-
bioRxiv - Immunology 2022Quote: The genome-wide library Toronto KnockOut (TKO) CRISPR Library – Version 3 (TKOv3, #90294, Addgene) 39 ...
-
bioRxiv - Genetics 2020Quote: ... The U6:3 promoter was PCR amplified from pAC-U63-tgRNA-Rev (Addgene #112811). The CR7T promoter was synthesized as a gBlock DNA fragment (IDT ...
-
bioRxiv - Neuroscience 2019Quote: ... with different fluorescent protein genes and helper plasmids (3 μg pcDNA-SADB19N (Addgene, 32630), 1.5 μg pcDNA-SADB19P (Addgene ...
-
bioRxiv - Cancer Biology 2021Quote: ... 293T cells were transfected with lentiviral packaging vectors (3 μg pSPAX2 (Addgene plasmid, 12260) and 1 μg pMD2.G (Addgene plasmid ...
-
bioRxiv - Microbiology 2022Quote: MacroH2A1 guide RNA (gRNA, see Table 3) was cloned into TLCv2 (Addgene plasmid: 87360), a plasmid encoding doxycycline-inducible Cas9-2A-GFP and gRNA expression ...
-
bioRxiv - Microbiology 2022Quote: ... PCMV4-3 HA/IκBα (SS32,36AA) was a gift from Warner Greene (Addgene plasmid #24143) and pLVX-EF1α-IRES-Puro was purchased from Clontech Laboratories (plasmid #631988).
-
bioRxiv - Genetics 2023Quote: ... 3 µg of the plasmid pCMV-VSV-G (a gift from Bob Weinberg (Addgene plasmid #8454 ...
-
bioRxiv - Cell Biology 2023Quote: ... HEK293 cells were transfected with pFlagCMV2-14-3-3sigma (Addgene, Cambridge, MA, Plasmid #12453) (68) ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV9-FLEX-tdTomato was injected (pAAV-FLEX-tdTomato from Addgene, #28306, titer 3 ✕ 1012). Viruses were diluted in D-phosphate-buffered saline (PBS) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and envelope (3 µg of pMD2.G, Addgene #12259, a gift from Didier Trono) vectors using FuGENE6 (11 815 091 001 ...
-
bioRxiv - Genetics 2023Quote: ... The three gRNA-expressing modules were prepared in pKSB-sgRNA1—3 (Addgene #173671—173673) as described (Dong et al. ...
-
bioRxiv - Bioengineering 2024Quote: ... and 3′ extension oligos were cloned into pU6-tevopreq1-GG-acceptor (Addgene No.174038) by Golden Gate Assembly as previously described14 ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 3 μg of PX459 plasmid (kind gift from Feng Zhang; Addgene plasmid ##62988) expressing both cas9 and a cloned gRNA (5’-TCTCCCATGCATTCAAACTG-3’ ...
-
bioRxiv - Bioengineering 2024Quote: ... and pET28a-SnoopTag-SpyTag-(AffiHER2)3 (GenBank accession no. KU296976) (Addgene deposition in progress) (Veggiani et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... Nsp1-NT (1-127 aa) and Nsp1-CT (128-180 aa) were amplified from pDONR207 SARS-CoV-2 NSP1 (Addgene) by PCR and then cloned into pDB-His-MBP or BacMam pCMV-Dest plasmid ...
-
bioRxiv - Bioengineering 2022Quote: ... sgRNA cassette) were PCR-amplified and recloned into 2 lentiviral plasmids (pLKO.1 neo, Addgene #13425; pLJM-EGFP, Addgene #19319) and ...
-
bioRxiv - Neuroscience 2020Quote: ... injections of rAAV2-retro-Cre (produced by Salk Vector Core or Vigene, 2×1012 to 1×1013 viral genomes/ml, produced with capsid from Addgene plasmid #81070 packaging pAAV-EF1a-Cre from Addgene plasmid #55636 ...
-
bioRxiv - Microbiology 2021Quote: Individual sgRNAs (sgLRRC15 #1: GACATGCAGGCACTGCACTG; sgLRRC15 #2: AGTGTCAGCCCGGGACATGC; sgACE2: GTTACATATCTGTCCTCTCC) targeting the candidate genes were cloned into linearized pXPR_502 (Addgene, #96923) for CRISPR activation ...
-
bioRxiv - Cell Biology 2022Quote: ... talin 2 shRNA-stable cells were co-transfected with Tln1 siRNA and EGFP-talin 1 head (Addgene plasmid no. 32856) or EGFP-talin 1 L325R (the mutant version ...
-
bioRxiv - Immunology 2020Quote: ... with lentiviral packaging vectors pCAG-eco and psPAX.2 plus empty pLKO.1 control (EV) with a puromycin selection cassette (all obtained from Addgene) or a shRNA containing pLKO.1 targeting DGAT1 (GE Dharmacon CAT# RMM4534-EG13350 - TRCN0000124791) ...
-
bioRxiv - Neuroscience 2020Quote: ... The loxP-NeoR-loxP cassette was inserted at the MluI site in the intron between exons 1 and 2 following PCR amplification from pL452 (Addgene) using primers 3-For and 3-Rev ...
-
bioRxiv - Immunology 2022Quote: ... with lentiviral packaging vectors pCAG-eco and psPAX.2 plus empty pLKO.1 control (EV) with a puromycin selection cassette (all obtained from Addgene) or a shRNA containing pLKO.1 targeting Cpt1a (GE Dharmacon CAT# RMM3981-201819967 – TRCN0000110596 ...
-
bioRxiv - Cell Biology 2022Quote: ... was constructed by recombining pENTR1a emGFP-Slc37a2 iso 2 with the pLenti PGK Hygro DEST (w530-1) vector (a gift from Eric Campeau and Paul Kaufman, Addgene plasmid # 19066 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Nsp1-NT (1-127 aa) and Nsp1-CT (128-180 aa) were amplified from pDONR207 SARS-CoV-2 NSP1 (Addgene) by PCR and then cloned into pDB-His-MBP or BacMam pCMV-Dest plasmid ...
-
bioRxiv - Neuroscience 2023Quote: ... injections of rAAV2-retro-Cre (produced by Salk Vector Core or Vigene, 2×1012 to 1×1013 viral genomes/ml, produced with capsid from Addgene plasmid #81070 packaging pAAV-EF1a-Cre from Addgene plasmid #55636 ...
-
bioRxiv - Cancer Biology 2024Quote: ... sgRNA oligonucleotides purchased from IDT were annealed and ligated in the BbsI restriction site of pX330A-1×2 (Addgene, #58766) plasmid to make pX330A-1x2-cNAT10 vector ...
-
bioRxiv - Cell Biology 2024Quote: ... we received plasmids encoding WT SARS-CoV-2 SP (Wuhan-Hu-1) and its receptor binding domain (RBD) from Addgene under a Material Transfer Agreement ...
-
bioRxiv - Immunology 2020Quote: ... devil NLRC5 was amplified from pAF105 with overlapping ends to the 5’ and 3’ SfiI sites of the Sleeping Beauty transposon plasmid pSBbi-BH42 (a gift from Eric Kowarz; Addgene # 60515, Cambridge, MA, USA) using Q5® Hotstart High-Fidelity 2X Master Mix (New England Biolabs (NEB) ...
-
bioRxiv - Molecular Biology 2019Quote: ... we designed and generated a CRISPR plasmid targeting the 5′– GTTTGCCCATTACTCTT/CAT(PAM:AGG)–3′ sequence using pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene #42260, gift from Dr. Feng Zhang), according to a published protocol (Ran et al ...
-
bioRxiv - Cell Biology 2021Quote: Stock of lentiviral particles were obtained by transfection of HEK293T cells (2×106 cells) with 2 μg of lentivector plasmid lentiCRISPRv2 (a gift from Feng Zhang, Addgene plasmid, 52961) expressing single guide RNA targeting an exon within ATG5 gene ...
-
bioRxiv - Immunology 2020Quote: ... pTwist EF1 Alpha-SARS-Cov-2-S-2xStrep plasmid encoding for the SARS-CoV-2 Spike protein was a gift from Nevan Krogan (Addgene plasmid #141382). pcDNA3-sACE2(WT)-Fc(IgG1 ...
-
bioRxiv - Bioengineering 2022Quote: ... we generated 2 sgRNA plasmids each harboring 2 distinct sgRNAs targeting the promoter regions of eve (AAEL007369, OA-1053A, Addgene plasmid #184006) and hh (AAEL006708 ...
-
bioRxiv - Neuroscience 2023Quote: ... were secured in a stereotaxic frame and unilateral or bilateral injections of fluorogold or choleratoxin B subunit tracers dissolved in glycerol (FG 2% iontophoresis by 2 µA pulses with 2/2 s on/off duty cycle for 5 minutes and CTB 0.5% iontophoresis by 5 µA pulses with 2/2 s on/off duty cycle for 7-10 minutes) or retrograde pAAVrg-CAG-GFP (Addgene: 37825-AAVrg) or retrograde AAVrg-EF1a-mCherry-IRES-Flpo (Addgene ...
-
Safe plant Hsp90 adjuvants elicit an effective immune response against SARS-CoV2 derived RBD antigenbioRxiv - Molecular Biology 2023Quote: ... pseudo-type lentiviruses coated with the SARS-CoV-2 S protein harboring the vector pCMV14-3X-Flag-SARS-CoV-2 S (a gift from Zhaohui Qian (Addgene plasmid #145780) were prepared by co-transfecting HEK293T cells with psPAX2 (a gift from Didier Trono (Addgene plasmid # 12260 ...
-
bioRxiv - Cell Biology 2020Quote: ... GFP-C1(2)δ (Tobias Meyer, Addgene plasmid #21216), GFP-nes-2xPABP (Sergio Grinstein ...
-
bioRxiv - Biochemistry 2022Quote: ... pBBR1MCS-2 was a gift from Kenneth Peterson (Addgene plasmid # 85168 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and SARS-CoV-2-S variant (pCDNA 3.1_Spike_Del19, Addgene) at a ratio of 1:2:1 using the transfection reagent (Lipofectamine 3000 ...
-
bioRxiv - Biophysics 2019Quote: ... mCherry-Peroxisomes-2 (peroxisome lumen marker, Addgene plasmid #54520) were gifts from Michael Davidson ...
-
bioRxiv - Immunology 2021Quote: ... 2) luciferase reporter plasmid pLenti-CMV Puro-Luc (Addgene), and 3 ...
-
bioRxiv - Bioengineering 2021Quote: pcDNA3-SARS-CoV-2-S-RBD-sfGFP (Addgene #141184) and pcDNA3-R4-uAb (Addgene #101800 ...
-
bioRxiv - Biochemistry 2020Quote: ... overnight cultures of Rosetta 2 (DE3)/pMSP1D1 (Addgene #20061) were diluted 1:100 in LB (Difco ...
-
bioRxiv - Developmental Biology 2020Quote: ... and 2.5 ng/µl Pmyo-2::mCherry (Addgene #19327). Three injected animals were pooled and incubated for 3 days at 20 °C before adding 250 ng/µl of hygromycin per plate ...
-
bioRxiv - Microbiology 2021Quote: ... pBMTL-2 was a gift from Ryan Gill (Addgene plasmid # 22812 ...
-
bioRxiv - Bioengineering 2021Quote: ... (2) chloramphenicol resistance cassette from pTARA[52] (Addgene #39491), (3 ...
-
bioRxiv - Bioengineering 2021Quote: ... (2) chloramphenicol resistance cassette from pTARA[52] (Addgene #39491), (3 ...
-
bioRxiv - Cancer Biology 2020Quote: ... pMDG.2 (a gift from Didier Trono, Addgene #12559) and the lentiviral expression construct ...
-
bioRxiv - Genetics 2020Quote: ... and 2 µg of pMD2.G (Addgene, Cat# 12259)—using Lipofectamine (ThermoFisher ...