Labshake search
Citations for Addgene :
51 - 100 of 1265 citations for 5 M TOLYL FURAN 2 CARBALDEHYDE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... sgRNAs 5’-CCCCATGGACATACCCACTG-3’ and 5’-CCAGTCGAGCAGAAAAGTGT-3’ defining a 244 bp region in Nodal exon 2 were cloned into pX458 (Addgene plasmid #48138) or pX459 (Addgene plasmid #48139 ...
-
bioRxiv - Microbiology 2020Quote: The SNAP-tag gene was PCR amplified from pSNAP-tag(m) (Addgene #101135) and cloned into pVpr-IN.eGFP(Albanese et al. ...
-
bioRxiv - Plant Biology 2019Quote: ... Clover coding sequence was amplified from Clover-mRuby2-FRET-10 (M. Davidson, Addgene) with oGD317 and oGD318 and cloned in pGGD000 with a linker made up by annealing oGD315 and oGD316 (D-TGCA linker ...
-
bioRxiv - Genetics 2020Quote: ... Dapi labelled the nuclei and m-Cherry-TNGP-N-10 (Addgene, Cat # 55145) localized the Golgi ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/5: pAAV2/5 was a gift from Melina Fan (Addgene plasmid # 104964 ...
-
bioRxiv - Neuroscience 2020Quote: ... and pAAV-EF1α-FLEX-GTB (a gift from Edward M. Callaway; Addgene plasmid #26197), respectively ...
-
bioRxiv - Molecular Biology 2022Quote: ... The M-MLV* reverse transcriptase in ciPE2 was PCR-amplified from pCMV_PE2 (Addgene #132775), a gift from David Liu ...
-
bioRxiv - Genomics 2023Quote: ... 20 μg of pAdDeltaF6 (a gift from James M. Wilson, Addgene plasmid # 112867, RRID:Addgene_112867), 7 μg of pAP215-M1 library plasmid ...
-
bioRxiv - Genomics 2023Quote: ... 20 μg of pAdDeltaF6 (a gift from James M. Wilson, Addgene plasmid # 112867, RRID:Addgene_112867), 7 μg of pAP215-M1 library plasmid ...
-
bioRxiv - Cell Biology 2023Quote: ... PhOTO-M (pMTB:memb-Dendra2-2A-H2B-Cerulean) was a gift from Periklis Pantazis (Addgene plasmid # 92401 ...
-
bioRxiv - Neuroscience 2021Quote: ... targeted to mouse PGRN exon 1 (oligos with 5’-cacc gGCTCCCTGGGAGGCATCTGG-3’ and 5’-aaac CCAGATGCCTCCCAGGGAGCc-3’ or 5’-cacc gCGGACCCCGACGCAGGTAGG-3’ and 5’-aaac CCTACCTGCGTCGGGGTCCGc-3’ were ligated to pLenti-CRISPRv2 (Addgene)) or Cas9 only ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV2/5 (Addgene #104964), pAAV2/6 (Addgene #110660) ...
-
bioRxiv - Molecular Biology 2023Quote: Constructs for shRNA targeting Primpol (5’- ATTTAGCCGACACCTAATATT) Smarcal1 (5’- CTGATTCAAGAGAAGATTAAA) and Smug1 (5’- AACTATGTGACTCGCTACT) were designed and inserted into pLKO.1neo plasmid (Addgene #13425). Lentiviruses were generated using a standard protocol (Feng and Jasin ...
-
bioRxiv - Neuroscience 2022Quote: ... were subcloned into the MluI and XhoI restriction sites of pENN.AAV.hSyn.Cre.WPRE.hGH (a gift from James M. Wilson (Addgene plasmid # 105553; http://n2t.net/addgene:105553; RRID:Addgene_105553)) ...
-
bioRxiv - Neuroscience 2022Quote: ... were subcloned into the MluI and XhoI restriction sites of pENN.AAV.hSyn.Cre.WPRE.hGH (a gift from James M. Wilson (Addgene plasmid # 105553 ...
-
bioRxiv - Cell Biology 2023Quote: ... stock AAV8.TBG.PI.Cre.rBG (AAV8-TBG-Cre; a gift from James M. Wilson (Addgene plasmid #107787); stored at -80°C ...
-
bioRxiv - Bioengineering 2022Quote: ... with 2 μg MLC-2 plasmid (pEGFP-MRLC1, Addgene, #35680), 10 μg RAR-β siRNA (Santa Cruz ...
-
bioRxiv - Neuroscience 2023Quote: ... The 5-HT1eR and 5-HT1FR PRESTO-Tango constructs were obtained from Addgene. For transfection ...
-
bioRxiv - Neuroscience 2023Quote: ... virus for optogenetic inhibition or excitation of preBötCOT-R neurons in OT-R::Cre mice was obtained from Addgene (Table 2, Addgene viral prep # 154951 ...
-
bioRxiv - Neuroscience 2023Quote: ... The AAV1-phSyn1(S)-FLEX-tdTomato-T2A-SypEGFP-WPRE virus for tracing experiments from preBötCOT-R neurons to nACardiac neurons in OT-R::Cre mice was obtained from Addgene (Table 2, Addgene viral prep # 51509 ...
-
bioRxiv - Molecular Biology 2019Quote: ... and the indicated amounts of M-ST1-sgRNA (v0) (Addgene #48672, a gift from George Church) (Esvelt et al. ...
-
bioRxiv - Cell Biology 2021Quote: Early passage HeLa-M cells were transfected with 1.5 µg of px459 plasmid (Addgene plasmid #62988) containing a single guide RNA (sgRNA ...
-
bioRxiv - Neuroscience 2023Quote: ... or GFP and Synaptophysin-RFP cDNA (pRVdG-N-P-M-EGFP-SynPhRFP-L, Addgene plasmid #52483), and with these additional plasmids ...
-
bioRxiv - Cell Biology 2023Quote: ... Plasmids Ub-M-GFP and Ub-R-GFP were a gift from Nico Dantuma (Addgene #11939) (Dantuma et al. ...
-
bioRxiv - Neuroscience 2019Quote: ... forward primer-5’-AGCAGCACGACTTCTTCAAGTCC and reverse primer 5’-TGTAGTTGTACTCCAGCTTGTGC (modified protocol from Addgene, USA). A known concentration (2 × 109 molecules/µl ...
-
bioRxiv - Cell Biology 2020Quote: ... 5′-CAAACAATCAGCAATGCCTG-3′ and 5′-TGAAGTATTCAGAACAGAAG-3′ and cloned into pX330-P2A-EGFP (Addgene) through ligation using T4 ligase (New England Biolabs) ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 μg pVSV (#138479, Addgene), 8 μg psPAX2 (#12260 ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV2/5 (Addgene Plasmid #104964), and pHelper (Cell Biolab ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 µg pRSV-Rev (Addgene 12253 ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 μg p8.9NdeltaSB (Addgene #132929) and 0.5 μg pCMV-VSV-G (Addgene #8454) ...
-
Linear ubiquitination at damaged lysosomes induces local NF-κB activation and controls cell survivalbioRxiv - Cell Biology 2023Quote: ... GFP as non-human target (NHT) control (5’-GGAGCGCACCATCTTCTTCA-3’, 5’-GCCACAAGTTCAGCGTGTC-3’, and 5’-GGGCGAGGAGCTGTTCACCG-3’) cloned into pLentiCRISPRv2 (Addgene, 52961, deposited by Feng Zhang). To generate lentiviral particles ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV2/2 (Addgene 104963), adenovirus helper plasmid pAdDeltaF6 (Addgene 112867 ...
-
bioRxiv - Microbiology 2020Quote: ... The plentiCRISPRV.2 (Addgene) was digested with BsmBI and ligated with guide RNA sequences specific for IFNAR1 ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV2/2 (Addgene #104963), pAAV2/5 (Addgene #104964) ...
-
bioRxiv - Cancer Biology 2021Quote: The M-CSF promoter reporter (pMCSF-R-luc Addgene plasmid # 12420; http://n2t.net/addgene:12420; RRID: Addgene_12420)(Zhang et al. ...
-
bioRxiv - Biochemistry 2021Quote: ... Ub-M–GFP (#11938) and Ub-R–GFP (#11939) plasmids described in [45] were purchased from Addgene. HA tagged USP5 (#22590 ...
-
bioRxiv - Neuroscience 2022Quote: ... pENN-AAV1-hSyn-Cre-WPRE (titer: 1.8×10e13 GC/ml, Addgene 105553, gift from James M. Wilson) was injected into the piriform cortex or medial prefrontal cortex ...
-
bioRxiv - Molecular Biology 2023Quote: ... AAVMYO2 (8) or AAVMYO3 (8)) and pAdDeltaF6 helper (a gift from J. M. Wilson Addgene, plasmid # 112867) plasmid using PEI MAX (Polyscience) ...
-
bioRxiv - Cell Biology 2021Quote: ... and AAV packaging plasmid expressing Rep2/Cap5 genes for production of serotype 5 – pAAV2/5 (RRID:Addgene_104964).
-
bioRxiv - Neuroscience 2024Quote: ... we obtained the AAV2/5 virus of the GFAP -tdTomato vector from Addgene (#44332-AAV2/5). Titers ranged from 1-4 x 1013 vg/mL.
-
bioRxiv - Plant Biology 2022Quote: ... pICH41402 (Addgene #50285; ΩTMV 5’UTR), pAGM47523 (Addgene #153221 ...
-
bioRxiv - Biophysics 2022Quote: ATG12–5-16L1-GFP constructs (Addgene_169077) were expressed and purified from SF9 cells as described25 (dx.doi.org/10.17504/protocols.io.br6qm9dw) ...
-
bioRxiv - Immunology 2019Quote: ... pCMV-DR8.2 (5 ng, Addgene #12263) and 2.5 μg of the lentiviral vector ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5 μg of VSV.G (#14888, Addgene) and 5 μg pCL-Eco (#12371 ...
-
bioRxiv - Neuroscience 2022Quote: ... titer: 5 × 1012 GC/ml (Addgene viral prep # 18917-AAV1 ...
-
bioRxiv - Neuroscience 2023Quote: ... or AAV2/5.EF1a-eYFP.WPRE.hGH (Addgene, titer ≥ 7×10¹2 vg/mL ...
-
bioRxiv - Cell Biology 2023Quote: ... and 5 μg pMD2G (12259; Addgene) using Lipofectamine 2000 according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 µg of pMDLg/pRRE (Addgene 12251 ...
-
bioRxiv - Neuroscience 2020Quote: ... AAV1-CamKII-GCaMP6f (pENN.AAV.CamKII.GCaMP6f.WPRE.SV40 was a gift from James M. Wilson – Addgene viral prep #100834-AAV1; http;//n2t.net/addgene:100834; RRID:Addgene_100834) was injected (∼50 nL at a depth of 1.25 mm below the surface of the dura ...
-
bioRxiv - Neuroscience 2020Quote: ... mice were injected with the virus encoding AAV9.CaMKII.GCaMP6f (pENN.AAV.CamKII.GCaMP6f.WPRE.SV40, gift from James M. Wilson, Addgene viral prep # 100834-AAV9) at the following coordinates ...