Labshake search
Citations for Addgene :
301 - 350 of 1265 citations for 5 M TOLYL FURAN 2 CARBALDEHYDE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2019Quote: ... A mixture of 3 transfection plasmids were produced by combining 2 µg pMDG.2 (Addgene #12259) (Addgene, Watertown, Massachusetts, USA); 4 µg of pCMV delta R8.2 (Addgene #12263 ...
-
bioRxiv - Microbiology 2022Quote: pCMV-GFP-SARS-CoV-ORF3a was generated by recombining the SARS-CoV-2-ORF3a coding sequence (pDONR207 SARS-CoV-2 ORF3aA, #141271, Addgene) into pDEST-CMV-N-EGFP (#122842 ...
-
bioRxiv - Neuroscience 2022Quote: ... and AAV2-hSyn-mCherry (UNC vector core) (Figures 2, 6, & 7; Figure 2 – Figure supplement 1) or retrograde AAV-hSyn-DIO-eGFP (Addgene) and retrograde AAV-hSyn-mCherry (Addgene ...
-
bioRxiv - Microbiology 2022Quote: UAS-SARS-CoV-2-ORF3a transgenic flies were generated by PCR-mediated subcloning of the SARS-CoV-2-ORF3a coding sequence (pDONR207-SARS-CoV-2 ORF3a, #141271, Addgene) into pUASt-Attb (EcoRI/XbaI) ...
-
bioRxiv - Cancer Biology 2023Quote: ... shRNA 2 (shYAP1 #2) or scramble shRNA (shNC) were inserted into pLKO.1-TRC Cloning Vector (Addgene, 10878, RRID: Addgene_10878) following the manufacturer’s protocol and sequenced ...
-
bioRxiv - Cancer Biology 2023Quote: ... shRNA 2 (shYAP1 #2) or scramble shRNA (shNC) were inserted into pLKO.1-TRC Cloning Vector (Addgene, 10878, RRID: Addgene_10878) following the manufacturer’s protocol and sequenced ...
-
bioRxiv - Neuroscience 2020Quote: ... 2 μg of tdTomato-Mito-7 (Addgene #58115) (36 ...
-
bioRxiv - Immunology 2021Quote: pcDNA3.1-SARS-CoV-2 Spike (Addgene plasmid #145302) was used to clone SARS-CoV-2 S gene into the SFG backbone using the In-Fusion Cloning kit (Takara Bio) ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 µg of psPAX2 (Addgene, #12260, MA, USA) and 2 µg of lentiCRISPRv2 sgRNA DMT1 ...
-
bioRxiv - Genetics 2020Quote: ... and pCFJ90 Pmyo-2-mCherry (Addgene plasmid 19327) and pCFJ104 Pmyo-3-mCherry (Addgene plasmid 19328)(Frøkjær-Jensen et al. ...
-
bioRxiv - Biochemistry 2020Quote: ... and combined with pX330A-2-PITCh (Addgene #63670) by golden gate cloning ...
-
bioRxiv - Molecular Biology 2023Quote: ... PITCh sgRNA from pX330S-2-PITCh (Addgene #63670) was cut-out via Eco31I (Thermo Fisher Scientific ...
-
bioRxiv - Pathology 2023Quote: ... 2 µg of pCA-mTmG plasmid (#26123, Addgene) was added to diluted TAT-Cre and incubated at 37°C for 1 hour ...
-
bioRxiv - Microbiology 2023Quote: ... and pDONR223 SARS-CoV-2 spike (Addgene #149329) were subcloned into pLVpuro-CMV-N-3xFLAG (Addgene #123223 ...
-
bioRxiv - Microbiology 2023Quote: ... and pMD.2 (Didier Trono, Addgene plasmid # 12259), combined with either Cas9 expression vector plenti-Cas9-blast (Feng Zhang ...
-
bioRxiv - Biophysics 2023Quote: The plasmid pr8ΔEnv.2 was obtained from Addgene, Plasmid #12263) ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV9-EF1a-DIO-hChR2-EYFP (1:2, Addgene viral prep # 20298- AAV9 ...
-
bioRxiv - Plant Biology 2023Quote: ... the AtCas9 (2×35S::AtCAS9-OCST; Addgene #112079) and the linker pICH41780 (Addgene #48019 ...
-
bioRxiv - Neuroscience 2024Quote: ... 85 nl of AAV1-hSyn:Cre (Addgene, 2 × 1013) was injected into vCA1 and 200 nl of a 1:1 cocktail of AAV9-pMeCP2:DIO-Cas9 (2 × 1012 GC/ml ...
-
bioRxiv - Neuroscience 2024Quote: ... and pAAV2/2 (for AAV2; Addgene plasmid # 104963), pAAV2/5 (for AAV5 ...
-
bioRxiv - Bioengineering 2024Quote: ... and exon 2-8 was cloned from Addgene #182141 ...
-
bioRxiv - Cancer Biology 2024Quote: ... PITCh sgRNA from pX330S-2-PITCh (Addgene #63670) vector was then inserted into the pX330A-1x2-cNAT10 vector using Golden Gate Assembly (New England Biolab ...
-
bioRxiv - Plant Biology 2020Quote: ... pICH47742::2x35S-5′UTR-hCas9 (STOP)-NOST (Addgene no. 49771), pICH41780 (Addgene no ...
-
bioRxiv - Neuroscience 2020Quote: ... the AAV2/5-gfaABC1D-tdTomato was purchased from AddGene (44332), and the AAV2/5-hSyn-hChR2(H134R)-mCherry was purchased from the UNC Vector Center ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 5 pmol DNA plasmids (1.5 pmol psPAX2 (Addgene #12260), 1.5 pmol pMD2.G (Addgene #12259 ...
-
bioRxiv - Neuroscience 2022Quote: ... 5 μg VSV-G expressing envelope plasmid (pMD2.G, Addgene) and 4 μg plasmid of interest (e.g ...
-
bioRxiv - Neuroscience 2019Quote: ... and 5 µl of AAV1-hSyn-eGFP-WPRE-bGH (Addgene; also pre-diluted to a 1:4 ratio in filtered 1x PBS) ...
-
bioRxiv - Neuroscience 2022Quote: ... mRuby-ER-5 was a gift from Michael Davidson (Addgene plasmid #55860 ...
-
bioRxiv - Cell Biology 2023Quote: ... the hCRISPRi-V2 compact library (Addgene #83969, 5 sgRNAs/TSS) was transduced at a MOI (multiplicity of infection <1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and TGFBR2 (5’-ccttgtagacctcggcgaag-3’) cloned into LentiCRISPRv2 puro (Addgene) (20) ...
-
bioRxiv - Neuroscience 2023Quote: ... Suppl Fig 3: AAV9-CaMKIIa-hChR2-EYFP (1:5, Addgene viral prep #26969- AAV9 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and the PMD2.G (5 μg) envelope construct (Addgene # 12259) were added to the solution ...
-
bioRxiv - Microbiology 2021Quote: ... 2 x 105 cells were seeded on 12-well plates and transiently transfected with 2 μg of plasmids encoding SARS-CoV-2 N (Addgene # 141391) or eGFP (Addgene # 141395 ...
-
bioRxiv - Neuroscience 2020Quote: A subsample of rats (n = 4, 2 males and 2 females) received bilateral retrograde AAV-CAG-TdTomato (59462-AAVrg; Addgene, MA) in mPFC (PL/IL ...
-
bioRxiv - Cancer Biology 2023Quote: ... AAACTCGGAGTTCTCAGAGCCCAGC NFKB2 guide #1 F: CACCGTGGCCCCTACCTGGTGATCG NFKB2 guide #1 R: AAACCGATCACCAGGTAGGGGCCAC NFKB2 guide #2 F: CACCGCTTTCGGCCCTTCTCACTGG NFKB2 guide #2 R: AAACCCAGTGAGAAGGGCCGAAAGC pLKO.TRC (Addgene; Cat#10878) was used for generating shNMNAT1 KD in U-87 MG and U-251 MG cell lines ...
-
bioRxiv - Microbiology 2023Quote: ... pLVX-EF1a-SARS-CoV-2-nsp16-IRES-puro was generated by subcloning the nsp16 coding sequence from pDONR223 SARS-CoV-2 NSP16 (Addgene #141269) into pLVX-EF1a-IRES-puro empty vector ...
-
bioRxiv - Microbiology 2023Quote: ... cells were transfected with 250 ng of plasmids encoding the SARS-CoV-2 S genes delivered by pTwist-SARS-CoV-2 Δ18 D614G (Addgene, 164437) or pTwist-SARS-CoV-2 Δ18 B.1.1.529 (Addgene ...
-
bioRxiv - Microbiology 2024Quote: ... Plasmids expressing GST-tagged WT Dynamin 2 or Dynamin 2 ΔPRD were constructed using the Takara Biosciences In-Fusion system and a plasmid encoding rat WT Dynamin 2 (Addgene 34684) as a template ...
-
bioRxiv - Neuroscience 2023Quote: ... Male (N = 2) and female (N = 2) naïve mice were infused bilaterally with the anterograde tracer AAV8-Syn-mCherry (Addgene, Watertown, MA) in the CeA (0.2 µL) ...
-
bioRxiv - Cancer Biology 2023Quote: ... from the expression vector pcDNA3.1/Myc-His(-)-HSulf-2 bearing human Sulf-2 cDNA (a gift from Steven Rosen, Addgene plasmid # 13004) (Morimoto-Tomita et al. ...
-
bioRxiv - Cell Biology 2021Quote: Stock of lentiviral particles were obtained by transfection of HEK293T cells (2×106 cells) with 2 μg of lentivector plasmid lentiCRISPRv2 (a gift from Feng Zhang, Addgene plasmid, 52961) expressing single guide RNA targeting an exon within ATG5 gene ...
-
bioRxiv - Immunology 2020Quote: ... pTwist EF1 Alpha-SARS-Cov-2-S-2xStrep plasmid encoding for the SARS-CoV-2 Spike protein was a gift from Nevan Krogan (Addgene plasmid #141382). pcDNA3-sACE2(WT)-Fc(IgG1 ...
-
bioRxiv - Bioengineering 2022Quote: ... we generated 2 sgRNA plasmids each harboring 2 distinct sgRNAs targeting the promoter regions of eve (AAEL007369, OA-1053A, Addgene plasmid #184006) and hh (AAEL006708 ...
-
bioRxiv - Neuroscience 2023Quote: ... were secured in a stereotaxic frame and unilateral or bilateral injections of fluorogold or choleratoxin B subunit tracers dissolved in glycerol (FG 2% iontophoresis by 2 µA pulses with 2/2 s on/off duty cycle for 5 minutes and CTB 0.5% iontophoresis by 5 µA pulses with 2/2 s on/off duty cycle for 7-10 minutes) or retrograde pAAVrg-CAG-GFP (Addgene: 37825-AAVrg) or retrograde AAVrg-EF1a-mCherry-IRES-Flpo (Addgene ...
-
Safe plant Hsp90 adjuvants elicit an effective immune response against SARS-CoV2 derived RBD antigenbioRxiv - Molecular Biology 2023Quote: ... pseudo-type lentiviruses coated with the SARS-CoV-2 S protein harboring the vector pCMV14-3X-Flag-SARS-CoV-2 S (a gift from Zhaohui Qian (Addgene plasmid #145780) were prepared by co-transfecting HEK293T cells with psPAX2 (a gift from Didier Trono (Addgene plasmid # 12260 ...
-
bioRxiv - Cell Biology 2020Quote: ... GFP-C1(2)δ (Tobias Meyer, Addgene plasmid #21216), GFP-nes-2xPABP (Sergio Grinstein ...
-
bioRxiv - Biochemistry 2022Quote: ... pBBR1MCS-2 was a gift from Kenneth Peterson (Addgene plasmid # 85168 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and SARS-CoV-2-S variant (pCDNA 3.1_Spike_Del19, Addgene) at a ratio of 1:2:1 using the transfection reagent (Lipofectamine 3000 ...
-
bioRxiv - Biophysics 2019Quote: ... mCherry-Peroxisomes-2 (peroxisome lumen marker, Addgene plasmid #54520) were gifts from Michael Davidson ...
-
bioRxiv - Immunology 2021Quote: ... 2) luciferase reporter plasmid pLenti-CMV Puro-Luc (Addgene), and 3 ...