Labshake search
Citations for Addgene :
401 - 450 of 580 citations for Recombinant Mouse Cd5 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... mouse Lhx2 cDNA was amplified from TetO-FUW-Lhx2 (Addgene #61537 ...
-
bioRxiv - Cell Biology 2022Quote: Mouse Drp1 was PCR amplified from pcDNA3.1 mDrp1 (Addgene #34706) and cloned into pLenti BlastR using InFusion cloning ...
-
bioRxiv - Molecular Biology 2020Quote: Mouse GFP-PGC-1α full length (FL) plasmid (Addgene, #4) was used as template for PCR amplification of a delta C-terminal domain (ΔCTD ...
-
bioRxiv - Cell Biology 2021Quote: The pcDNA 3.1 (-) mouse C/EBPδ expression vector (AddGene, #12559) and annealed oligonucleotides (Supplementary Table S4 ...
-
bioRxiv - Biophysics 2023Quote: ... Mouse TRPM5 in pcDNA3.1 was purchased from Addgene (plasmid #85189), human TRPM5 in pcDNA3.1+ (Accession No ...
-
bioRxiv - Molecular Biology 2023Quote: ... untagged mouse cDNA into a pBig1a vector70 (Addgene, Plasmid #80611). These untagged RING1B and BMI1 constructs were used for all experiments presented in this manuscript with the exception for the data presented in Figure 6C ...
-
bioRxiv - Molecular Biology 2024Quote: Mouse Two Plasmid Activity-Optimized CRISPR Knockout Library (Addgene#1000000096) was amplified in E coli ...
-
bioRxiv - Cancer Biology 2024Quote: The mouse GeCKO v2 library was obtained from Addgene (#1000000052). LentiCRISPRv2 is a one-vector plasmid system for the mouse GeCKO (Genome-scale CRISPR Knockout ...
-
bioRxiv - Genomics 2019Quote: ... from mouse tail genomic DNA and pX330 plasmid (Cat. 42230, Addgene), respectively ...
-
bioRxiv - Cancer Biology 2022Quote: Guides were quantified against the Yusa Mouse V2 library (Addgene #67988) using crisprReadCounts v1.3.1 (https://github.com/cancerit/crisprReadCounts) ...
-
bioRxiv - Neuroscience 2020Quote: ... Mouse nAChR alpha4 CFP was a gift from Henry Lester (Addgene plasmid # 15244 ...
-
bioRxiv - Biochemistry 2021Quote: Mouse Bpnt2 cDNA was cloned into the pBABE-puro (Addgene #1764) retroviral vector using BamHI and SalI restriction sites ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... a mouse KO sgRNA pooled library (Addgene: #1000000096, 10sgRNA per gene) was amplified at 1000X fold coverage ...
-
bioRxiv - Physiology 2020Quote: ... the mouse N-Shh sequence was then cloned in pRRLsin.MND.MCS.WPRE (Addgene) that had been previously digested by NheI and PmlI ...
-
bioRxiv - Cell Biology 2020Quote: ... Mouse Mannosidase II amino acids 1-116 was amplified from Addgene plasmid #65261 using a forward primer that contains an XbaI site and a reverse primer with an MluI site and further subcloned upstream of the mCherry open reading frame.
-
bioRxiv - Cell Biology 2022Quote: Mouse SEPT6-GFP construct was purchased from Addgene (Addgene plasmid# 38296) and was cloned into the pLVX-IRES-puro vector (Clontech) ...
-
bioRxiv - Immunology 2023Quote: pcDNA3-N-Flag-NLRP3 plasmid encoding mouse NLRP3 (Addgene plasmid # 75127) was a gift from Bruce Beutler61 ...
-
bioRxiv - Molecular Biology 2023Quote: The Mouse Improved Genome-wide Knockout CRISPR Library v2 (Addgene #67988) collection sgRNAs in lentiviral vectors targeting 18 ...
-
bioRxiv - Genetics 2020Quote: Mouse Arid1a gRNA (GCTGCTGCTGATACGAAGGTTGG) was cloned into LentiGuide-puro plasmid (Addgene #53963). LentiCas9-Blast plasmid was purchased from Addgene (Addgene #53962) ...
-
bioRxiv - Cell Biology 2020Quote: ... The mouse HA-Bnip3ΔExon3 (sNip) (Accession #MF156210) were described previously (Addgene #100793) [39] ...
-
bioRxiv - Cancer Biology 2021Quote: A promoter and enhancer element upstream of mouse Fabp4 (from Addgene #8858) was cloned into pAAV-iCre-WPRE (Vector Biosystems ...
-
bioRxiv - Molecular Biology 2021Quote: ... coding sequence of mouse Cry1 and firefly Luciferase in pG5luc plasmid (Addgene) was amplified with primers having EcoRV-NotI and NotI-XhoI flanking sites for Crys and Luc ...
-
bioRxiv - Cell Biology 2020Quote: ... we used a mouse pooled kinome CRISPR-Cas9 pooled library (#75316, Addgene) (23) ...
-
bioRxiv - Cancer Biology 2022Quote: ... the mouse Snai1 gene was amplified from pTK-Snai1 plasmid (#36976, Addgene) using primers (forward ...
-
bioRxiv - Cancer Biology 2023Quote: The mouse Genome-Scale CRISPR Knock-Out (mGeCKO) library A (Addgene #1000000052), composed of ∼68,000 gRNAs ...
-
bioRxiv - Cell Biology 2022Quote: ... The plasmid encoding the scFv(H2)-Fc(mouse) is available from Addgene; #190691 ...
-
bioRxiv - Developmental Biology 2023Quote: The mouse Runx1 overexpression plasmid pCDNA3.1-Flag-Runx1 was purchased from Addgene. The mouse Runx2 plasmid pCMV-Flag-mRunx2 was purchased from Origene ...
-
bioRxiv - Biochemistry 2023Quote: ... pCMV5 mouse Src was a gift from Joan Brugge & Peter Howley (Addgene plasmid # 13663 ...
-
bioRxiv - Physiology 2024Quote: ... (1.3 × 1011 plaque-forming units per mouse, ((107787-AAV8, Addgene, Watertown, MA)) ...
-
bioRxiv - Neuroscience 2024Quote: ... Mouse PSD95 sequence was a gift from Gary Bassell (Addgene plasmid #102949). TurboID was fused at the C-terminus of PSD95 and inserted into a cre-dependent AAV expression vector under the synapsin promoter by Gibson assembly (NEB) ...
-
bioRxiv - Microbiology 2021Quote: ... lentivirus that harbored the mouse GeCKOv2 sgRNA library in the lentiCRISPRv2 vector (Addgene) was produced in HEK293FT cells (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2021Quote: ... one DATcre mouse was injected with AAV8-hSyn-DIO-mCherry (Addgene, cat#50459) in midbrain (SNc ...
-
bioRxiv - Cell Biology 2022Quote: ... human KIFC1(125-673) and mouse BICD2(15-595) were obtained from Addgene (plasmids #133242 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Mouse ULK1 cDNA was isolated from a p3xFLAG-CMV14-mULK1 vector (#24301, Addgene) by PCR and cloned into the Halo-tagged pFN21A vector (Promega ...
-
bioRxiv - Neuroscience 2023Quote: ... pCAG_MMP-9 – full length mouse (MMP-9) from pcDNA3.1_MMP-9-HA (Addgene #121172) cloned into pCAG vector ...
-
bioRxiv - Genetics 2023Quote: ... Codon-optimized of full-length mouse RNF212B was cloned into pET-28b (+) (Addgene) with a C-terminal 6xHis tag ...
-
bioRxiv - Microbiology 2023Quote: The Mouse Genome-wide Knockout CRISPR sgRNA Library was purchased from Addgene (#67988)5 ...
-
bioRxiv - Neuroscience 2023Quote: ... pCDNA3-mouse PKA-RIalpha-mEGFP (Addgene plasmid # 45525; http://n2t.net/addgene:45525; RRID:Addgene_45525), pcDNA3-mouse PKA-RIbeta-mEGFP (Addgene plasmid # 45526 ...
-
bioRxiv - Neuroscience 2023Quote: ... pcDNA3-mouse PKA-RIbeta-mEGFP (Addgene plasmid # 45526; http://n2t.net/addgene:45526; RRID:Addgene_45526), and pCDNA3-mouse PKA-RIIalpha-mEGFP (Addgene plasmid # 45527 ...
-
bioRxiv - Neuroscience 2024Quote: ... and Cdk5rap2 from mouse and human were cloned into FUGW (Addgene plasmid # 14883) [52] ...
-
bioRxiv - Cell Biology 2020Quote: ... Expression plasmids for WT and catalytic mutant mouse Lipin-1 were obtained from Addgene. Lipin-1 siRNA 5’-GAAUGGAAUGCCAGCUGAA-3’ and 3’-UUCAGCUGGCAUUCCAUUC-5’ (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: The truncated mouse Fzd2 gene (Fzd2-delN) was cloned from pRK5-mFzd2 (#42254, Addgene) with a 1D4 tag at the C terminus by PCR using the following primers ...
-
bioRxiv - Cell Biology 2020Quote: ... GFP and gRNAs against mouse Ampkα1 (79004) and Ampkα2 (79005) were obtained from Addgene. C2C12 cells were first transfected with Ampkα1 gRNA and sorted with GFP ...
-
bioRxiv - Genetics 2022Quote: ... mouse cGAS was amplified via PCR from a pMSCVpuro-eGFP-cGAS template (Addgene, 108675) using primers containing KpnI and NotI restriction sites (S1 Table) ...
-
bioRxiv - Cell Biology 2020Quote: Mouse GeCKOv2 CRISPR knockout pooled library was a gift from Feng Zhang (Addgene # 1000000052). To prepare lentivirus particles ...
-
bioRxiv - Neuroscience 2023Quote: ... and pCDNA3-mouse PKA-RIIalpha-mEGFP (Addgene plasmid # 45527; http://n2t.net/addgene:45527; RRID:Addgene_45527) were gifts from Haining Zhong 73 ...
-
bioRxiv - Neuroscience 2019Quote: Mouse Rit2 (mRit2) cloned into pGEX2T was a gift from Julian Downward (Addgene plasmid #55663)[59] ...
-
bioRxiv - Cancer Biology 2019Quote: SgRNAs targeting mouse Wnt5a or Yap1 were cloned into pSpCas9(BB)-2A-Puro (Addgene, #62988) and transfected into target cells ...
-
bioRxiv - Cell Biology 2021Quote: The full length mouse SUMO2 fused to HA (N-terminus) from a plasmid (Addgene 48967) [67] were inserted in the retroviral transfer plasmid pCX4 Puro ...
-
bioRxiv - Molecular Biology 2020Quote: ... mouse PGC-1α FL and ΔCTD were PCR-amplified from the pcDNA-f:PGC1 (Addgene, # 1026) and pcDNA-f:PGC1(delta CTD ...