Labshake search
Citations for Addgene :
351 - 400 of 580 citations for Recombinant Mouse Cd5 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: The human MPST expression plasmid with the N-terminal His tag with TEV cleavage site (MPSTA) was a gift from Nicola Burgess-Brown (Addgene plasmid #42482). This construct was co-expressed with chaperones groEL ...
-
bioRxiv - Molecular Biology 2024Quote: The human MPST expression plasmid with the N-terminal His tag with TEV cleavage site (MPSTA) was a gift from Nicola Burgess-Brown (Addgene plasmid #42482). The N-terminal His tag construct of human MPST was co-transformed with GroES-EL chaperon plasmid from Takara (#3340) ...
-
bioRxiv - Microbiology 2020Quote: ... The plasmid used for constructing recombinant virus was pVSVΔG-eGFP (where eGFP is enhanced green fluorescent protein; plasmid 31842; Addgene). GPC was cloned into the ΔG site ...
-
bioRxiv - Immunology 2020Quote: ... The recombinant DNA encoding TCRMART-1 was synthesized by GeneScript (Nanjing, China) and ligated into pRRLSIN.cPPT.PGK vector (Addgene, 12252).
-
bioRxiv - Neuroscience 2023Quote: ... The recombinant AAV to express SaCas9 was created using plasmid pAAV-EFS-SaCas9-P2A-HAFLAGHA-KASH-pA (Addgene, #113688). For constructs for REST4 expression ...
-
bioRxiv - Cell Biology 2020Quote: ... Stable expression of fluorescently tagged ciliary and centriolar proteins was achieved by modification of pCW-Cas9 using cDNAs encoding ARL13B (Addgene #40879, gift from Tamara Caspary), EHD1 (gift from Chris Westlake) ...
-
bioRxiv - Cell Biology 2024Quote: ... N-terminal FLAG-tagged CAPS was created by recombining the human CAPS gene (CAPS/pENTR; DNAsu HscD00514950) into pEZFLAG (Addgene#18700; Guo et al., 2008) using Gateway cloning ...
-
bioRxiv - Genomics 2019Quote: ... coli expressing Streptococcus Pyogenes Cas9 carrying a C-terminal fusion to a hexa-histidine tag from the pET-28b-Cas9-His plasmid (Addgene http://www.addgene.org/47327) (56) ...
-
bioRxiv - Biochemistry 2020Quote: hnRNPA2 LC S285C and S329C variants for PRE, insoluble His-tag purification as described (Ryan et al., 2018) (Addgene ID: 98665, 98667 respectively)
-
bioRxiv - Biophysics 2023Quote: ... and its variants were cloned into the pEG-BacMam expression vector with GFP and 8X-His tags at the N-terminus (Addgene, see Table S2). For FLAG-tagged KRAS expression constructs ...
-
bioRxiv - Cell Biology 2020Quote: Plasmids for the expression of recombinant α-Syn were: pT7-7 α-Syn (Addgene plasmid #3604636; http://n2t.net/addgene:36046; RRID:Addgene_36046) and pT7-7 α-Syn A53T (Addgene plasmid #10572737 ...
-
bioRxiv - Neuroscience 2021Quote: ... Mice were unilaterally injected with recombinant adeno-associated virus (rAVV) carrying the GCaMP6s transgene (pAAV.Syn.GCaMP6s.WPRE.SV40) purchased from Addgene (viral prep #100843-AAV1) with titer of 1-5×1012 in dorsal dentate gyrus using a Nanoject syringe (Drummond Scientific ...
-
bioRxiv - Biochemistry 2020Quote: Recombinant wild-type Streptococcus pyogenes Cas9 REC3 domain (506-712) possessing an amino-terminal His10-MBP tag (Addgene, no. 101205) followed by a TEV protease site was expressed in Escherichia coli strain BL21(DE3 ...
-
bioRxiv - Genetics 2020Quote: Cas9 recombinant protein was expressed in Escherichia coli BL21 (DE3) from plasmid pMJ915 (a gift from Jennifer Doudna; Addgene # 69090) and purified as previously described (34) ...
-
bioRxiv - Neuroscience 2020Quote: To express oChIEF-mCitrine in pOXR1-Cre mice, a recombinant adeno-associated virus (rAAV, serotype 1, 4.8×1013 VC/ml titer) expressing FLEXed oChIEF-mCitrine (Addgene #50973) was package by Vector Biolabs (Malvern ...
-
bioRxiv - Cell Biology 2022Quote: ... Recombinant His6-mCerulean and His6- mTurquoise2 were prepared similarly using pBAD-mCerulean and pBAD-mTurquoise plasmids (Addgene, #54666 and #54844) and TOP10 competent cells (Thermo Fisher ...
-
bioRxiv - Neuroscience 2023Quote: ... were injected in the right IC with the recombinant adeno-associated virus (rAAV) rAAV1/ Syn-Flex-Chronos-GFP (Lot # AV6551B, UNC Vector Core, Addgene # 62725 ...
-
bioRxiv - Cell Biology 2023Quote: After production of recombinant lentiviruses in HEK293T cells by co-transfection of the pLentiCRISPRv2 constructs with pMD2.G and psPAX2 (Addgene plasmids #12259 and #12260 ...
-
bioRxiv - Molecular Biology 2023Quote: - recombinant pGEX-4T-3-P53: The human-p53 cDNA was previously cloned in the EcoRI site of pGEX-4T3 (Addgene_79149) under the lac-trp hybrid promoter that is inducible by IPTG ...
-
bioRxiv - Biochemistry 2024Quote: ... The pOPIN-B vector was used for recombinant PLpro expression and was a gift from Ray Owens (Addgene plasmid # 41142). All oligos used in this study were ordered from IDT ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... Cas9 protein was produced by the Weizmann Institute of Science Protein Purification Unit using the pET-28b-Cas9-His (Alex Schier Lab Plasmids, Addgene, Cambridge, MA, United States) as a template ...
-
bioRxiv - Cell Biology 2020Quote: ... The recombinant WNK1 kinase domain was eluted via addition of 50 nM bdSENDP1 protease (Frey et al., 2014; Addgene ID 104962) in wash buffer 4.
-
bioRxiv - Cell Biology 2022Quote: ... The mammalian expression plasmid for Ism1 with C-terminal myc-6xhis tag plasmid for recombinant Ism1 protein production was from Addgene (#173046).
-
bioRxiv - Plant Biology 2021Quote: ... and Cas9 RNP nucleofection were performed according to Huang et al.30 Cas9 recombinant protein was overexpressed in Escherichia coli BL21 harboring the plasmid pMJ915 (Addgene # 69090). Cas9 protein was purified and stored at −80°C in Cas9 RNP buffer (20 mM HEPES at pH 7.5 ...
-
bioRxiv - Biochemistry 2022Quote: ... For expression of recombinant drosophila c-Src isoform 42A (Src42A, UniProtKB Q9V9J3) we used a pET-His10-Src42A plasmid (Addgene #126674) codifying a full-length drosophila isoform (aa 1-517 ...
-
bioRxiv - Neuroscience 2023Quote: ... An additional round of CRISPR/Cas9 genome editing was performed on one clonal cell line to further disrupt the coding region of endogenous Scn9a using recombinant pX458 plasmid (pSpCas9-2A-GFP; Addgene #48138) and a gRNA targeting the in-frame deletion (Scn9a ...
-
bioRxiv - Molecular Biology 2020Quote: ... Mouse Ddx5 WT(Addgene plasmid #88869) and Lys144 to Asn mutant(Addgene plasmid #88870 ...
-
bioRxiv - Neuroscience 2022Quote: ... and mouse IgG1 Fc (Addgene #28216) and IgG2a Fc (Addgene #114492) ...
-
bioRxiv - Neuroscience 2023Quote: ... pCDNA3-mouse PKA-RIalpha-mEGFP (Addgene plasmid # 45525 ...
-
bioRxiv - Neuroscience 2023Quote: ... pcDNA3-mouse PKA-RIbeta-mEGFP (Addgene plasmid # 45526 ...
-
bioRxiv - Neuroscience 2021Quote: For Ca2+ indicator expression at M1, recombinant AAV vectors (rAAVs, serotype 1) encoding jRGECO1a under the control of the synapsin promoter (Addgene #100854-AAV1) was stereotaxically delivered as follows ...
-
bioRxiv - Biochemistry 2023Quote: ... Ttyh1 was expressed from a pLX304 vector after addition of C-terminal Strep and His tags to an existing construct (Addgene #161676, a gift from Mike McManus). To stably express fluorescently tagged Prom1 WT and W795R variants in HeLa cells for live cell imaging ...
-
bioRxiv - Cell Biology 2024Quote: ... a gift from Zuoshang Xu)63 and cloned in frame with the N-terminal 6- His-SUMO-TEV-site into the SspI site of pET 6His-SUMO-TEV LIC (1S) (Addgene 29659, a gift from Scott Gradia) using the HiFi Assembly kit (NEB) ...
-
bioRxiv - Developmental Biology 2021Quote: A mouse Cnr1 cDNA fragment (Addgene, #13391) was cloned into all-in-one tetracycline inducible plasmid (pAS4.1w.Ppuro-aON ...
-
bioRxiv - Cell Biology 2021Quote: ... and mCherry-Climp63(mouse) (Addgene plasmid #136293) were gifts from Gia Voeltz36 ...
-
bioRxiv - Neuroscience 2023Quote: ... and pCDNA3-mouse PKA-RIIalpha-mEGFP (Addgene plasmid # 45527 ...
-
bioRxiv - Neuroscience 2021Quote: Pyramidal cell imaging experiments were performed by injecting a recombinant adeno-associated virus (rAAV) encoding GCaMP6f (rAAV1-Syn-GCaMP6f-WPRE-SV40, Addgene/Penn Vector Core) into male wild-type mice.
-
bioRxiv - Biochemistry 2020Quote: ... anti-mouse IgG AlexaFluor-488 (Life Technologies A11029-EA. The following plasmids were used: mouse PM20D1-flag (Addgene 84566). pENN.AAV.tMCK.PI.eGFP.WPRE.bGH (Addgene 105556) ...
-
bioRxiv - Cell Biology 2021Quote: Plasmid pT7-7 α-Syn A53T for the expression and purification of recombinant α-Syn was a gift from Hilal Lashuel (Addgene plasmid #10572784) and EGFP-α-SynA53T plasmid for α-Syn expression in HEK293T and SH-SY5Y cells was a gift from David Rubinsztein (Addgene plasmid #4082385)).
-
bioRxiv - Immunology 2022Quote: HEK293A cells stably expressing mouse NLRP3 (Addgene 75127), and ASC-GFP (Addgene 73957 ...
-
bioRxiv - Neuroscience 2021Quote: ... plus empty pEGFP and mouse neuroligin-1B (Addgene #15261 ...
-
bioRxiv - Cell Biology 2021Quote: ... The generation of mouse myc-Bnip3 (Addgene #100796) was described previously 48 ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse GeCKOv2 CRISPR knockout pooled library (Addgene #1000000053,18), pMD2.G and psPAX2 were transfected into Lenti-X 293T cells ...
-
bioRxiv - Genetics 2021Quote: ... or the catalytic domain (CD) of mouse Dnmt3a and the C-terminal part of mouse Dnmt3L (3a3L) (amplified from pET28-Dnmt3a3L-sc27 (Addgene #71827)) and cloned in PiggyBac plasmids under control of the TRE3G promoter ...
-
bioRxiv - Cancer Biology 2020Quote: ... two independent sgRNA against mouse Chk2 (GTATACATAGAGGATCACAG and GCTGGAGACAGTGTCTACCC) or mouse Trp53 (56) were cloned into pKLV-U6gRNA(BbsI)-PGKpuro2ABFP (Addgene, 50946). Lentiviral packaging plasmids (1µg pCMV-Rev ...
-
bioRxiv - Molecular Biology 2023Quote: Polymerase chain reaction (PCR) was used to isolate mouse AMPKγ1 cDNA from a mouse AMPKγ1-HA vector (#40605, Addgene, Watertown, MA, USA). Mouse AMPKγ1 cDNA was then cloned into the 3xFLAG-CMV10 vector (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2022Quote: ... and mCherry-Snx9 (#27678) (all mouse) were from Addgene.
-
bioRxiv - Neuroscience 2020Quote: ... Postsynaptic mouse neuroligin-1 was PCR amplified from Addgene #15260 ...
-
bioRxiv - Biophysics 2023Quote: ... mouse Opa1 sequence was cloned into pR26-CMVconst (Addgene plasmid #127373 ...
-
bioRxiv - Genetics 2024Quote: Mouse CRISPR Brie lentiviral pooled library (Addgene Plasmid # 170511) consisting of 79,637 gRNAs was co-transfected with packaging plasmids (psPAX2 and pMD2.G ...