Labshake search
Citations for Addgene :
401 - 450 of 1974 citations for Recombinant Human Ribulose 5 Phosphate 3 Epimerase His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... human c-MYC (RRID:Addgene_17220) and ESRG (6 μg each ...
-
bioRxiv - Cell Biology 2021Quote: ... pcDNA3-HA-14-3-3 beta (14-3-3β) was a gift from Michael Yaffe (Addgene #13270). pclbw-opa1(isoform 1)-myc (myc-Opa1 ...
-
bioRxiv - Cell Biology 2020Quote: ... A plasmid expressing 8X-His-TEV-8X-Arg tag protease was obtained from Addgene and purified according to the published protocol (Tropea et al. ...
-
bioRxiv - Bioengineering 2019Quote: ... TGFB1-bio-His (proTGFβ) which was a gift from Gavin Wright (Addgene plasmid # 52185) [17] and HA-OVOL2 (OVOL2 ...
-
bioRxiv - Cell Biology 2019Quote: ... A plasmid expressing 8X-His-TEV-8X-Arg tag protease was obtained from Addgene and purified according to the published protocol(Tropea et al. ...
-
bioRxiv - Biochemistry 2022Quote: ... pET29b-IPP1-His was a gift from Sebastian Maerkl & Takuya Ueda (Addgene plasmid # 124137). 15µL of Lemo21(DE3 ...
-
bioRxiv - Microbiology 2022Quote: ... coli MG1655 into a His-SUMO-TEV (HST) plasmid backbone (Addgene product number: 48313). Each HST construct was grown in LB to an OD600 of 0.4 at 37°C ...
-
bioRxiv - Cell Biology 2023Quote: ... purified from bacteria cells transformed with the plasmid pET-28b-RfxCas13d-His (Addgene 141322), was kindly provided by JP Concordet ...
-
bioRxiv - Biochemistry 2023Quote: GST-HRAS and His/MBP-KRAS were purchased from Addgene (#55653 and # 159546, respectively). GST-KRAS was created with standard Gibson Assembly (NEB ...
-
bioRxiv - Cancer Biology 2021Quote: Plasmid RB-GFP FL for expression of GFP-tagged RB was obtained from Addgene (Catalog #16004). For ectopic gene expression ...
-
bioRxiv - Molecular Biology 2021Quote: ... 20 ng reference reporter (pcDNA3.1-Nanoluc-3xFLAG-V5) and 50 ng 3xFLAG tagged constructs (Addgene #87063). Transfection was carried out using Lipofectamine 3000 reagent (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... iEC-ESCs and iHUF cells were tagged with Azurite blue using pLV-Azurite (Addgene plasmid 36086). Lentiviral transductions were performed according to manufacturers’ protocols and successfully tagged cells were further sorted on a Beckman Coulter MoFlow Astrios (Indianapolis ...
-
Formation of a giant unilocular vacuole via macropinocytosis-like process confers anoikis resistancebioRxiv - Cell Biology 2024Quote: ... The cDNAs for eGFP-tagged SpvB(Salmonella SpvB 375-591) sequence were obtained from Addgene (#89446) and cloned into the pMSCV-puro vector.
-
bioRxiv - Cancer Biology 2024Quote: ... containing a C-terminus EGFP-tagged sequence of the full-length M237I p53 protein (Addgene, #11770), and 4 µL of Lipofectamine 2000 reagent ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’-AAAGTGGGACGCGGCACCTA-3’ from Zhang lab database) was cloned as synthetic dsDNA into lentiCRISPRv2 vector (provided by F. Zhang, Addgene plasmid #52961) as described (Sanjana et al. ...
-
bioRxiv - Cell Biology 2019Quote: ... containing the FOXJ1 targeting sgRNA sequence 5’-GGGCCTTCTTGTAAGAGGCC-3’ or the CCDC40 targeting sgRNA sequence 5’-CTCCTCGTTGGCGGCTGCGCAGG-3’ with 1 μg of MBX plasmid (gift from Linzhao Cheng, Addgene plasmid #64122) and 1 μg of homemade donor plasmid pUC19_FOXJ1_mCherry_cNEO for the FOXJ1_mCherry tagging project were mixed with 4 μL of Lipofectamine and left at room temperature for 10 min to form complexes ...
-
bioRxiv - Developmental Biology 2021Quote: ... cloning to insert SOX9 5’ and 3’ homologous arms in EasyFusion T2A-H2B-GFP plasmid (a gift from Janet Rossant, Addgene plasmid # 112851). AAVS1 repair template was created by Infusion cloning to swap the CAG promoter and Puromycin resistance cassette in plasmid AICSDP-42 ...
-
bioRxiv - Developmental Biology 2021Quote: ... SOX2 knockout repair template was created by Infusion cloning to insert SOX2 5’ and 3’ homologous arms in EasyFusion T2A-H2B-GFP (a gift from Janet Rossant, Addgene plasmid # 112851). SFTPC targeting repair template was created by Infusion assembly of SFTPC 5’ and 3’ homologous arms together with T2A-Rox-EF1a-Rox-Venus-NLS ...
-
bioRxiv - Neuroscience 2021Quote: 8-12 weeks old Ucn3::Cre male (n =5) and female (n=3) mice were stereotaxically injected with AAV1-eF1a-DoubleFlox hChR2(H134R)-mCherry-WPRE-HgHpA (Addgene, Cambridge, MA) bilaterally into the PeFA (AP −0.6 ...
-
bioRxiv - Cancer Biology 2020Quote: ... The HK2-targeting sequence 5’-CCGGCCAGAAGACATTAGAGCATCTCTCGAGAGATGCTCTAATGTCTTCTGGTTTTTT-3’ was cloned in the pLKO.1 hygro vector (a gift from Bob Weinberg; Addgene plasmid #24150). HK2 expression in Huh7-GCK+/HK2+ and Huh7-GCK+/HK2−Sh was analyzed on cell lysates by western blotting (Supplementary Fig ...
-
bioRxiv - Molecular Biology 2022Quote: Synthesized IRIS guide RNA oligonucleotide (target sequence: 5’-CTGGGGCAAACACAAAAACCTGG-3’) was cloned into the BsmB1 sites of the lentiCRISPRv2 vector (a gift from Feng Zhang, Addgene plasmid #52961)50 following the protocol described by Sanjana et al.50 ...
-
bioRxiv - Immunology 2021Quote: Recombinant SARS-CoV-2 HexaPro spike and RBD were produced from Addgene plasmid #154754 (50 ...
-
bioRxiv - Molecular Biology 2021Quote: ... of 14-3-3 theta into pEBFP2-C1 (Addgene plasmid #54665). A CHIP plasmid78 was a gift from Leonard Petrucelli and the CHIP ORF was cloned into pCMV-C2-6myc ...
-
bioRxiv - Molecular Biology 2021Quote: ... Laccase2 Exons 1-3 (Hy_pMT Laccase2 Exons 1-3; Addgene #91799), and nLuc (Hy_pMtnA nLuc SV40 ...
-
bioRxiv - Cell Biology 2022Quote: ... GFP-Galectin-3 was subcloned from ptf-Galectin-3 (Addgene: 64149). pMXs-puro eGFP-p62 was a gift from Noboru Mizushima (Addgene plasmid # 38277 ...
-
bioRxiv - Cancer Biology 2019Quote: CXCR4 shRNA Sequence: 5’CCGGTCCTGTCCTGCTATTGCATTACTCGAGTAATGCAATAGCAGGACAGGATTTTTG 3’ was cloned into the 3rd generation transfer plasmid pLKO.1 TRC cloning vector (Addgene cat no. 10878) between unique AgeI and EcoRI sites downstream of the U6 promoter ...
-
bioRxiv - Neuroscience 2020Quote: ... rv 5’-ATTTTAACTTGC-TATTTCTAGCTCTAAAACAACCATGTTCCG-TATTCAGATGCACCAGCCGGGAATCGAACC-3’) that were cloned with a single Gibson Assembly reaction in a pCFD6 (Addgene plasmid # 73915; RRID: Addgene_73915) vector [27] which was previously digested with BbsI restriction enzyme.
-
bioRxiv - Cell Biology 2019Quote: ... NOX1 and NOX2 deletion constructs were generated by inserting PCR amplified 5’ UTR and 3’ UTR fragments of the target genes sequentially into backbone vector pFGL821 (Addgene #58223, hygromycin resistance), flanking the HPH (hygromycin B phosphotransferase ...
-
bioRxiv - Cancer Biology 2020Quote: OE19-dCas9-KRAB stable cells were generated by transfecting 1×106 OE19 cells with 7.5 μg Cas9 plasmid with guides targeting the AAVS1 locus (Addgene #42230; 5’-GGGGCCACTAGGGACAGGAT-3’) and 7.5 μg donor plasmid (pAAVS1-Puro-DNR ...
-
bioRxiv - Cell Biology 2022Quote: ... pAAV_hsyn_NES-his-CAMPARI2-F391W-WPRE-SV40 was a gift from Eric Schreiter (Addgene plasmid # 101061)31 ...
-
bioRxiv - Bioengineering 2021Quote: ... We created 2 bacterial expression vectors: pET28-His-MBP-NLS-RfxCas13d-NLS-HA (Addgene 171586) produces the protein RfxCas13d-sTag after cleavage of the N-terminal His-MBP fusion partner ...
-
Enzymatic RNA Biotinylation for Affinity Purification and Identification of RNA-protein InteractionsbioRxiv - Biochemistry 2020Quote: A plasmid encoding obligate dimeric TGT was cloned from the TGT-His plasmid (Addgene #138201) using DNA HiFi Assembly (New England Biolabs ...
-
bioRxiv - Molecular Biology 2021Quote: ... A1AT/ SERPINA1 and PAI1/ SERPINE1 cDNAs were amplified from SERPINA-bio-His plasmid (Addgene #52182) and SERPINE1-bio-his (Addgene #52077 ...
-
bioRxiv - Cell Biology 2021Quote: ... from the pcDNA3.1 Flag-His-ATM plasmid (kind gift of Michael Kastan; Addgene plasmid #31985) (67 ...
-
bioRxiv - Microbiology 2022Quote: ... 500 ml LB culture of pCDFDuet-1-6×His-SARS-CoV-2-NSP7/NSP8 (Addgene)-transformed E.coli BL21 DE3 strain was induced by isopropyl β-d-1-thiogalactopyranoside (IPTG ...
-
bioRxiv - Molecular Biology 2022Quote: Plasmid pET28HIS-hAPE1 (for WT His-APE1 protein) was a gift from Primo Schaer (Addgene plasmid #70757 ...
-
bioRxiv - Pathology 2024Quote: ... BL21(DE3)-RIL Escherichia coli cells were transformed with pJ4M-TDP43-MBP-His (Addgene 104480) and grown on LB/Kanamycin/Chloramphenicol plates then used to inoculate 2L of TB/Kan/Cam/2g dextrose ...
-
bioRxiv - Neuroscience 2023Quote: ... and the injections of AAV5-hSyn-NES-his-CaMPARI2-WPRE-SV40 (2.5x10^12gc/ml Addgene 200nl measured using a Nano Injector ...
-
bioRxiv - Molecular Biology 2021Quote: ... The HALO-tagged version of this plasmid was created by replacing eGFP with NGFR (Addgene plasmid 27489) using Gibson assembly (NEB) ...
-
bioRxiv - Neuroscience 2020Quote: ... GFP-tagged Gephyrin-FingR was a gift from Don Arnold (Addgene plasmid #46296 (Gross et al., 2013)) ...
-
bioRxiv - Neuroscience 2019Quote: ... the DNA cassette encoding KASH-tagged EGFP (EGFPKASH) (16) was amplified from the PX552 plasmid (Addgene #60958) by Phusion High-Fidelity DNA polymerase ...
-
bioRxiv - Genetics 2020Quote: ... FLAG-tagged PALB2 was a gift from Daniel Durocher (pDEST-FRT/T0-FLAG-PALB2, plasmid #71114, Addgene)30 ...
-
bioRxiv - Cell Biology 2022Quote: ... Lentivirus was generated in 293T cells by calcium phosphate cotransfection with psPAX2 (Addgene #12260), pCMV-VSV-g (Addgene #8454) ...
-
bioRxiv - Cell Biology 2020Quote: ... GST-14-3-3 (Plasmid 1942) expression vectors were obtained from Addgene and described 45–46.
-
bioRxiv - Neuroscience 2021Quote: ... (3) AAV8-Syn-ChR2(H134R)-GFP (3×108 g.c.; Addgene #58880-AAV8), and (4 ...
-
bioRxiv - Biochemistry 2022Quote: ... The 3-nitro-tyrosine incorporation plasmid (pAcBac1-3-nitroTyr-A7, Addgene # 141173) was as previously described.35
-
bioRxiv - Cell Biology 2021Quote: ... 3 μg psPAX2 (Addgene), and 3 μg pMD2.G (Addgene ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 (Addgene plasmid #96963)92 ...
-
bioRxiv - Biochemistry 2022Quote: CRISPR-Cas9-mediated gene ablation was carried out using a guide RNA targeting Cmas exon 4 (5’-TGTCGACGAGGCCGTTTCGC-3’) in the plasmid pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene plasmid #42230 from Feng Zhang) as used before.11 TSC were cotransfected with GFP-expressing plasmid peGFP-CI (Clontech ...
-
bioRxiv - Immunology 2020Quote: ... devil NLRC5 was amplified from pAF105 with overlapping ends to the 5’ and 3’ SfiI sites of the Sleeping Beauty transposon plasmid pSBbi-BH42 (a gift from Eric Kowarz; Addgene # 60515, Cambridge, MA, USA) using Q5® Hotstart High-Fidelity 2X Master Mix (New England Biolabs (NEB) ...