Labshake search
Citations for Addgene :
451 - 500 of 1974 citations for Recombinant Human Ribulose 5 Phosphate 3 Epimerase His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: ... we designed and generated a CRISPR plasmid targeting the 5′– GTTTGCCCATTACTCTT/CAT(PAM:AGG)–3′ sequence using pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene #42260, gift from Dr. Feng Zhang), according to a published protocol (Ran et al ...
-
bioRxiv - Biophysics 2022Quote: Recombinant MBP-FUS construct was kindly gifted by Nicolas Fawzi (Addgene plasmid #98651) and was expressed in BL21 (DE3 ...
-
bioRxiv - Physiology 2019Quote: ... as were plasmids for recombinant production of PGC-1α (Addgene #1028 and 1029) (Puigserver et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... Recombinant lentiviral particles were produced using a protocol provided by the manufacturer (Addgene). In brief ...
-
bioRxiv - Cell Biology 2022Quote: ... mRFP-GFP tandem fluorescent-tagged LC3 (tfLC3) was a gift from Tamotsu Yoshimori (Addgene plasmid # 21074; www.addgene.org/21074)51 ...
-
bioRxiv - Microbiology 2019Quote: ... C57BL/6 MEFs were transfected with GFP- or HA-epitope tagged ubiquitin plasmids (Addgene #11928 and #18712, respectively) 24 hours before infection ...
-
bioRxiv - Cancer Biology 2020Quote: The lentiviral construct containing a truncated version of 53BP1 tagged with mApple was a gift from Ralph Weissleder (Addgene plasmid # 69531; http://n2t.net/addgene:69531; RRID:Addgene_69531)) ...
-
bioRxiv - Cancer Biology 2022Quote: ... pLV-ER GFP encoding GFP tagged SEC61β was a gift from Pantelis Tsoulfas (Addgene plasmid #80069; http://n2t.net/addgene:80069; RRID:Addgene_80069), mEmerald-Rab11a-7 was a gift from Michael Davidson (Addgene plasmid #54245 ...
-
bioRxiv - Cancer Biology 2020Quote: The vector for V5-tagged active WNT11 was a gift from Xi He (Addgene plasmid #43824; http://n2t.net/addgene:43824; RRID:Addgene_43824)23 ...
-
bioRxiv - Cancer Biology 2020Quote: Expression plasmid encoding N-terminally Flag-tagged hFOXO1-3A (#13508) was purchased from Addgene (Cambridge, MA, pCDNA3 backbone). FOXO1-3A has Ala residue substitutions at Thr-24 ...
-
bioRxiv - Immunology 2021Quote: ... Monomeric MBP-tagged NLRP3NACHT-LRR (aa 134-1034) was subcloned into pLenti CMVie-IRES-BlastR (Addgene plasmid #119863) with addition of N-terminal FLAG-tag ...
-
bioRxiv - Microbiology 2024Quote: ... and 125 ng of FLAG-tagged Med26 (a gift from Joan Conaway and Ronald Conaway [Addgene plasmid #15367; http://n2t.net/addgene:15367; RRID:Addgene_15367)(59)] expression vectors ...
-
MANF regulates unfolded protein response and neuronal survival through its ER-located receptor IRE1αbioRxiv - Cell Biology 2020Quote: ... pEZYflag and pEZYmyc-His were a gift from Yu-Zhu Zhang (Addgene plasmids #18700 and #18701). Gateway destination vectors for BiFC for N- and C-terminal tagging with Venus fluorescent protein fragments (pEZY BiFC N NV ...
-
bioRxiv - Biochemistry 2021Quote: ... The His-Sumo bacterial version was codon optimized and cloned into K27-Sumo (Addgene ID 169193) via NEBuilder HiFi DNA Assembly Cloning Kit (NEB) ...
-
bioRxiv - Cell Biology 2021Quote: ... His-Strep2-tag from 438-SNAP-V3 vector a gift from Scott Gradia (Addgene plasmid # 55223) with inserting CATCATCATCATCATCACAGCAGCGGCCTGGTGCCGCGCGGCAGCCAT sequence right in front of Strep II gene by PCR primer ...
-
bioRxiv - Biochemistry 2020Quote: MBP-hnRNPA2 LC, soluble His-tag purification as described (Ryan et al., 2018) (Addgene ID: 98661)
-
bioRxiv - Cancer Biology 2023Quote: SULF2 ORF including C-terminal Myc-His tag was subcloned from its source vector (Addgene # 13003) to lentiviral transfer vector pHR-CMV-TetO2_3C-Twin-Strep (Addgene # 113883 ...
-
bioRxiv - Immunology 2022Quote: ... a 3’ LTR-restored lentiviral expression vector (Addgene #101337, hereafter LV-3’LTR) expressing a GFP reporter was used to express ACE2 or CD169 ...
-
bioRxiv - Cell Biology 2023Quote: ... Most of the genes related with 14-3-3 were acquired from Addgene and cloned into pMX plasmids ...
-
bioRxiv - Developmental Biology 2021Quote: ... GST-human β-catenin (Addgene #24193), and NLS-mCherry (Addgene #49313 ...
-
bioRxiv - Molecular Biology 2022Quote: ... pscALPSpuro-HsACE2 (human) (Addgene, MA, USA) were co-transfected with psPAX2 and pCMV-VSV-G packaging plasmids into HEK293T cells using FuGENE 6 (Promega ...
-
bioRxiv - Neuroscience 2023Quote: ... human a-SYN (A53T mutant) (Addgene), and mt-Keima (Addgene) ...
-
bioRxiv - Cancer Biology 2024Quote: ORF encoding human MARK2 (Addgene, 23404) was cloned into pFL system with an N-terminal Strep2SUMO tag ...
-
bioRxiv - Synthetic Biology 2020Quote: ... the human codon-optimized Cas9 coding sequence including two nuclear localization signals (SV40 NLS at the 5’ and nucleoplasmin NLS at the 3’) was amplified from hCas9 (Addgene #41815; http://n2t.net/addgene:41815) using primers F_Cas9 and R_Cas9 ...
-
bioRxiv - Immunology 2021Quote: Recombinant HA (rHA) proteins were expressed using the pcDNA 3.1+ plasmid (Addgene, Watertown, MA). Each HA gene was truncated by removing the transmembrane (TM ...
-
bioRxiv - Developmental Biology 2020Quote: Recombinant Lentiviral Vector encoding Myoc Y437H was constructed from plasmids pLentCMV-GFP(Addgene 17448)(Campeau et al. ...
-
bioRxiv - Cell Biology 2020Quote: Plasmids for the expression of recombinant α-Syn were: pT7-7 α-Syn (Addgene plasmid #3604636 ...
-
bioRxiv - Neuroscience 2022Quote: ... The recombinant AAV vector was pseudotyped with AAV5 capsid protein and packaged by Addgene.
-
bioRxiv - Cancer Biology 2023Quote: ... The recombinant plasmids were packaged into the lentivirus with pSPAX2 (Addgene, 12260, RRID: Addgene_12260) and pMD2.G (Addgene ...
-
bioRxiv - Cancer Biology 2023Quote: ... The recombinant plasmids were packaged into the lentivirus with pSPAX2 (Addgene, 12260, RRID: Addgene_12260) and pMD2.G (Addgene ...
-
bioRxiv - Cell Biology 2020Quote: ... The mouse N-terminal Flag-tagged TRAF6 (Flag-TRAF6) mammalian expression plasmid was purchased from Addgene (#21624, GenBank: BAA12705.1). N-terminally GST-tagged TRAF6 (GST-TRAF6 ...
-
bioRxiv - Cancer Biology 2020Quote: The lentiviral construct containing a truncated version of 53BP1 tagged with mApple was a gift from Ralph Weissleder (Addgene plasmid # 69531 ...
-
bioRxiv - Neuroscience 2020Quote: ... Dphox and phox vectors were C-terminally tagged with GFP by infusion cloning in frame into CAG-GFP (Addgene) using the following primers ...
-
bioRxiv - Cancer Biology 2021Quote: ... pcDNA3-based plasmids encoding FLAG-tagged wild type and SATA (S939A/T1462A)-mutant TSC2(51) were obtained from Addgene. The TSC2-5A (S939A ...
-
bioRxiv - Neuroscience 2022Quote: ... The AU1-tagged wild-type and two mutant (S2215Y and R2505P) mTOR constructs were gifts from Fuyuhiko Tamanoi (Addgene) 59 ...
-
bioRxiv - Immunology 2019Quote: ... 2×106 HEK293T cells stably expressing FLAG-tagged Hem1 were transiently transfected with 2 μg myc-Rictor plasmid (Addgene). Control HEK293T cells were transfected with myc-Rictor or 10 ng GFP-3xFLAG as described ...
-
bioRxiv - Cell Biology 2019Quote: ... His-tagged SEPT5 plasmid was constructed by PCR amplifying SEPT5 from pCMV-Myc-tagged SEPT5 (Addgene plasmid # 27272; http://n2t.net/addgene:27272; RRID: Addgene_27272) (Amin et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... A retrograde GFP-tagged adeno-associated virus rAAV2/1-retro (retrograde AAV-CAG-GFP; serotype “retro”, Addgene, Cat. # 37825) was pressure injected into M2 (170 ...
-
bioRxiv - Molecular Biology 2023Quote: All-in-one lentiviral plasmids for Dox-inducible expression of UNK without GFP in HeLa cells were created by insertion of the Flag-HA-tagged full-length WT or mutant UNK amplified from the corresponding entry vector into the pLIX_403 plasmid (Addgene_41395) between NheI and AgeI sites ...
-
Mediobasal hypothalamic FKBP51 acts as a molecular switch linking autophagy to whole-body metabolismbioRxiv - Neuroscience 2021Quote: ... A viral vector containing a Cre expressing cassette (pAAV-CMV-HI-eGFP-Cre-WPRE-SV40, Addgene; #105545) was used to induce Fkbp5 deletion in Fkbp5lox/lox mice ...
-
bioRxiv - Biochemistry 2020Quote: hnRNPA2 LC (190-341), insoluble His-tag purification as described (Ryan et al., 2018) (Addgene ID: 98657)
-
bioRxiv - Biochemistry 2022Quote: AR-LBD (663-919) containing an N-terminal His-tag and encoded in pET15b plasmid (Addgene #89083) was expressed in Rosetta (DE3 ...
-
bioRxiv - Cell Biology 2020Quote: ... and pET28a(+) (Addgene #69864-3), for His6-tag protein purification ...
-
bioRxiv - Systems Biology 2023Quote: ... and pMW#3 (Addgene #13350) destination vectors using LR Clonase (ThermoFisher) ...
-
bioRxiv - Molecular Biology 2023Quote: - vector pGEX-4T-3 (Addgene_79149) to express only GST protein for alternative screening.
-
bioRxiv - Systems Biology 2024Quote: ... and pMW#3 (Addgene #13350) destination vectors using LR Clonase (ThermoFisher #11791100) ...
-
bioRxiv - Cell Biology 2023Quote: ... JR20s were used to express Cas9 and our previously verified sgRNA (5’-TCGACAGCCTTATGGCGGAC-3’) targeting mouse PFN120 from pLentiCRISPRv2 (Addgene #52961; a gift from Feng Zhang) via lentiviral transduction ...
-
bioRxiv - Genetics 2021Quote: ... HEK293T cells were transfected using calcium phosphate with psPAX2 (gift from Didier Trono, Addgene No.12260), pCAG-Eco (gift from Arthur Nienhuis and Patrick Salmon ...
-
bioRxiv - Neuroscience 2023Quote: ... 6 × 107 RPE1 cells were infected with the human sgRNA library (Human GeCKO v2 Library Cat#1000000048, Addgene) at an MOI of ∼0.3 ...
-
bioRxiv - Biochemistry 2019Quote: ... and a mammalian expression vector pcDNA3 encoding hemagglutinin tagged constitutively active glycogen synthase kinase-3β (GSK-3β) (S9A) (pcDNA3-GSK3β, # 14754, RRID: Addgene_14754). The EGFP in pRK5 vector was first replaced by iRFP to construct an iRFP tagged WT tau by golden gate assembly (pRK5-iRFP-tau ...