Labshake search
Citations for Addgene :
401 - 450 of 1474 citations for Human Procollagen Type III N Terminal Propeptide PIIINP ELISA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... TDP-43 bacterial expression vector harboring a C-terminal MBP tag (pJ4M TDP-43-TEV-MBP-6xHis) was purchased from Addgene (Plasmid # 104480). TDP-43 mutations were generated by site-directed mutagenesis using QuikChange (Agilent ...
-
bioRxiv - Genetics 2020Quote: ... as a gene block with a C-terminal HA tag and cloned into pMSCV PIG (Puro IRES GFP empty vector) - a gift from David Bartel (Addgene plasmid # 21654). Retroviruses were generated using the retroPack system (Takara ...
-
bioRxiv - Molecular Biology 2023Quote: ... the N-terminal part of FUS protein was used from the plasmid pHR-FUSN-mChr-CRY2WT (a gift from Clifford Brangwynne; Addgene plasmid # 101223). The N-terminal part of SATB1 was cloned into the pCMV-CRY2-mCherry vector using a single BspEI restriction enzyme site from the full-length construct ...
-
bioRxiv - Neuroscience 2024Quote: ... For specific silencing of CA1 interhemispheric terminals in dSUB we injected 200 nl of AAV2/1 hSyn1-DIO-eOPN3-mScarlet-WPRE (Addgene 125713-AAV1). For retrograde tracing from dCA1 or dSUB we injected 150 nl of CtB-488 at 0.5% (Life Technologies ...
-
bioRxiv - Neuroscience 2024Quote: ... The pl-Synapsin-YFP-NavII-III construct (AIS marker) was obtained from Addgene (Plasmid #91246), and the fluorescent tag was replaced with EGFP ...
-
bioRxiv - Molecular Biology 2024Quote: ... the domain III/pURD construct and an integrase expression vector pgk-φC31/pCB92 (Addgene #18935) were co-transfected into Expi293F cells which were plated in a 6-well plate (Greiner Bio-One) ...
-
Rhes protein transits from neuron to neuron and facilitates mutant huntingtin spreading in the brainbioRxiv - Neuroscience 2021Quote: ... pEGFP-N-Drd1 plasmid was a gift from Kirk Mykytyn (Addgene, 104358), GFP-DRD2 plasmid was a gift from Jean-Michel Arrang (Addgene ...
-
bioRxiv - Biochemistry 2021Quote: ... pLPC-puro-N-Flag was a gift from Titia de Lange (Addgene plasmid # 12521 ...
-
bioRxiv - Cell Biology 2021Quote: ... The resulting PCR product was inserted into pLVpuro-CMV-N-EGFP (Addgene plasmid # 122848 ...
-
bioRxiv - Neuroscience 2020Quote: ... Sham animals included virgins injected with halorhodopsin (AAV1.CaMKIIa.eNpHR.EYFP; Addgene; N=1) that received no optical stimulation ...
-
bioRxiv - Cell Biology 2020Quote: ... mApple-SSTR3-N-17 was a gift from Michael Davidson (Addgene # 54949). SSTR3 was shuttled into CSII-EF lentiviral vector into XhoI/XbaI site by Gibson cloning using the primers aacacgctaccggtctcgagaattcatggccactgttacctatcctt and tgctcaccatcagatggctcagtgtgctgg for SSTR3 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and pcDNA3-RLUC-POLIRES-FLUC (a gift from N. Sonenberg; Addgene #45642) (Poulin et al. ...
-
bioRxiv - Microbiology 2020Quote: ... pCAG-VSV-N (#64087) and pCAGGS-T7Opt (#65974) were ordered from Addgene. S expressing pCAGGS vectors were used for the production of pseudoviruses ...
-
bioRxiv - Neuroscience 2023Quote: ... or AAV8-hSyn-DIO-GFP (Addgene, n=8, 4 male, 4 female) were injected bilaterally into the BNST (5 × 1012 titer ...
-
bioRxiv - Cancer Biology 2022Quote: ... FRA1 sequence from p6599 MSCV-IP N-HAonly FOSL1 vector (Addgene, 34897) was cloned into pLV-EF1α-IRES-puro vector (Addgene ...
-
bioRxiv - Molecular Biology 2024Quote: ... the SMARCAL1 coding sequence was cloned into pLEX_305-N-dTAG (Addgene #91797) by the Gateway system (Life Technologies/Thermo Fisher ...
-
LRBA balances antigen presentation and T-cell responses via autophagy by binding to PIK3R4 and FYCO1bioRxiv - Immunology 2024Quote: ... pVitro-hygro-N-myc-hVps34/Vps15-C-V5-his-plasmid (Addgene #24055), pEGFP-Atg14L (Addgene #21635 ...
-
bioRxiv - Neuroscience 2024Quote: ... or GCaMP8s (n = 7, pAAV1.Syn.GCaMP8s.WPRE, Addgene, titer order of magnitude 1012) was pressure ejected at 4 sites ∼200 μm below the dura (25 nl each ...
-
bioRxiv - Genomics 2024Quote: ... (pLEX_305-N-dTAG was a gift from James Bradner & Behnam Nabet (Addgene plasmid # 91797 ...
-
bioRxiv - Neuroscience 2024Quote: ... 6 × 107 RPE1 cells were infected with the human sgRNA library (Human GeCKO v2 Library Cat#1000000048, Addgene) at an MOI of ∼0.3 ...
-
bioRxiv - Biochemistry 2020Quote: ... wild-type and mutant 3xFLAG-CDK12 sequences were subcloned into lentiCas9-Blast (Addgene 52962) by replacing the Cas9 ORF with 3xFLAG-CDK12 ...
-
bioRxiv - Molecular Biology 2023Quote: ... wild-type MEFs were transduced with lentiviral particles containing the plasmids lentiMPHv2 (Addgene #89308) and lentiSAMv2 (Addgene #75112) ...
-
bioRxiv - Neuroscience 2024Quote: ... wild type mice were injected with AAV5-GFAP-hM3D(Gq)-mCherry (Addgene #50478-AAV5) into motor cortex (MC ...
-
bioRxiv - Immunology 2024Quote: ... The wild-type SARS-CoV-2 spike plasmid (HDM-SARS2-spike-delta21, Addgene #155130) was cloned with the additional D614G substitution ...
-
bioRxiv - Bioengineering 2024Quote: ... The wild-type SARS-CoV-2 spike plasmid (HDM-SARS2-spike-delta21, Addgene #155130) was cloned with the additional D614G substitution ...
-
bioRxiv - Cancer Biology 2024Quote: ... wild-type DAXX cDNA was cloned into the pInducer20 expression vector (Addgene Plasmid #44012), lentivirus was generated using the psPAX and pMD2.G packaging vectors (Addgene Plasmid #12260 and #12259 ...
-
bioRxiv - Systems Biology 2021Quote: ... human knockout CRISPR v1 library (Addgene #67989) (39) ...
-
bioRxiv - Microbiology 2021Quote: The human CRISPR Brunello library (Addgene 73178) (16 ...
-
bioRxiv - Neuroscience 2022Quote: ... including the human IgG1 Fc (Addgene #145165), and mouse IgG1 Fc (Addgene #28216 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Human Sin1.1 was PCR-amplified from Addgene 73388 plasmid (gift from Taekjip Ha32 ...
-
bioRxiv - Biochemistry 2024Quote: ... and recombinant human GST-CK2α (Addgene #27083) enzymes were produced in-house as previously described [30] ...
-
bioRxiv - Cell Biology 2023Quote: ... from human pcDNA3.1-2xFLAG-SREBP1a (#26801, Addgene), pcDNA3.1-2xFLAG-SREBP1c (#26802 ...
-
bioRxiv - Evolutionary Biology 2024Quote: Coding sequences for human RIPK1 (Addgene #78834), human RIPK2 (ORFeome ID #4886) ...
-
bioRxiv - Neuroscience 2021Quote: ... The BoxB reporter was pAc5.1C-Fluc-Stop-5BoxB (a gift from Elisa Izaurralde; Addgene plasmid #21301) (Behm-Ansmant et al. ...
-
bioRxiv - Cancer Biology 2023Quote: An XRN1 open-reading frame (ORF) clone deposited by Elisa Izaurralde was purchased from Addgene (#66596). The entire ORF was sequenced to confirm fidelity to the NCBI Reference Sequence NM_019001.5 ...
-
bioRxiv - Biochemistry 2024Quote: ... The RGS domain of human RGS16 (residue 86–205) and human Gαi1 (residues 31-354) were expressed in the pNIC-SGC1 vector (Addgene), and pProEXHTb vector (Invitrogen) ...
-
bioRxiv - Cell Biology 2020Quote: ... Each transfection consisted of 250 ng expression plasmid (pcDNA3-control (Addgene; n/a), pcDNA3-Sox2FLAG (homemad) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... the mEmerald tag was PCR amplified from mEmerald-PLK1-N-16 vector (Addgene #54234 ...
-
bioRxiv - Biophysics 2021Quote: ... was a gift from Michael Davidson (mApple-MAPTau-N-10, Addgene plasmid # 54925). Using the QuikChange II XL Site-Directed Mutagenesis kit (Agilent ...
-
bioRxiv - Cancer Biology 2021Quote: Cells were transfected overnight in 10cm plates with N-GFP-RelA (Addgene #23255) or C-Flag-Rela (Addgene #20012 ...
-
bioRxiv - Cell Biology 2020Quote: mRuby2-MannII-N-10 was a gift from Michael Davidson (Addgene plasmid # 55903)(83) ...
-
bioRxiv - Genetics 2020Quote: ... Dapi labelled the nuclei and m-Cherry-TNGP-N-10 (Addgene, Cat # 55145) localized the Golgi ...
-
bioRxiv - Cell Biology 2022Quote: ... The MAP4K4 sequence was cloned into a pLVpuro-CMV-N-EGFP (Addgene, #122848) lentiviral plasmid using the gateway system ...
-
bioRxiv - Microbiology 2023Quote: ... The codon-optimized HCoV-OC43 N sequence was amplified from plasmid # 151960 (Addgene) with primers HCoV-OC43-N c-opt(pLVX)_Fw (gaattcgccgccaccatgtccttcaccccggg ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV8-hSyn-DIO-hM4D(Gi)-mCherry (Addgene, n=8, 4 male, 4 female) or AAV8-hSyn-DIO-GFP (Addgene ...
-
bioRxiv - Microbiology 2023Quote: ... The LMP1 coding region was amplified from MSCV-N LMP1131 (Addgene plasmid #37962) and cloned into pRetroX-IRES-ZsGreen via Gibson Assembly ...
-
bioRxiv - Developmental Biology 2022Quote: ... the Rho1 CDS bearing an ACT to AAT mutation and a TGC to TAC mutation (T19N and C189Y, respectively) was synthesized and inserted to the C-terminal end of pCRY2PHR-mCherryN1 (Addgene, deposited by Chandra Tucker) through Gibson assembly ...
-
bioRxiv - Molecular Biology 2020Quote: ... His-tagged wild-type and D135S AlkB plasmids were obtained from Addgene (#79050 and #79051) and proteins were purified by a Ni-NTA column followed by cation exchange ...
-
bioRxiv - Cell Biology 2020Quote: ... Wild-type β-PheRS cDNAs were cloned into the pET LIC (2A-T) plasmid (Addgene). Then ...
-
bioRxiv - Molecular Biology 2023Quote: ... The type I-B Anabaena variabilis ATCC 29413 CAST was sub-cloned from Addgene (#168137) [16] ...