Labshake search
Citations for Addgene :
301 - 350 of 1474 citations for Human Procollagen Type III N Terminal Propeptide PIIINP ELISA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: Full-length and C-terminal truncated KDM6B cDNA was amplified by PCR from KDM6B plasmids (Addgene, #21212 and #21214) and subcloned into pLVX-Ubc-FLAG vector ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Dnmt3a CD and the C-terminal part of mouse Dnmt3L (3a3L) were amplified from pET28-Dnmt3a3L-sc27 (Addgene #71827). The resulting constructs (collectively ...
-
bioRxiv - Microbiology 2024Quote: ... and H4 with C-terminal mEmerald (mEm) fluorescent tags were a gift from Michael Davidson and obtained from Addgene (Cat ...
-
bioRxiv - Cell Biology 2024Quote: ... the cytosol-exposed domain of NIX (1-182aa) was fused to a C-terminal GST-tag through cloning into a pET-DUET1 vector (RRID:Addgene_223733). Point mutants were introduced by in vitro mutagenesis to generate NIX E72A/L75A/D77A/E81A (4A ...
-
bioRxiv - Cell Biology 2024Quote: ... the cytosol-exposed domain of BCL2L13 (1-465aa) was fused to a C-terminal GST-tag through cloning into a pET-DUET1 vector (RRID:Addgene_223744). Point mutants were introduced by in vitro mutagenesis to generate BCL2L13 W276A/I279A (ΔLIR1 ...
-
bioRxiv - Cell Biology 2024Quote: ... the cytosol-exposed domain of FUNDC1 (1-50aa) was fused to a C-terminal GST-tag through cloning into a pET-DUET1 vector (RRID:Addgene_223734). Point mutants were introduced by in vitro mutagenesis to generate FUNDC1 Y18A/L21A (ΔLIR ...
-
bioRxiv - Molecular Biology 2021Quote: The wild-type PIAS4 expressing construct was obtained from Addgene (#15208) and RNF4 from Origene (RC207273) ...
-
bioRxiv - Cell Biology 2024Quote: Lentiviral-TOP/FOP-dGFP-reporters (wild-type consensus plasmid TOP: Addgene plasmid #14715 ...
-
bioRxiv - Cell Biology 2023Quote: ... Wild type Keratin 8 was cloned into pGEX-6p-1 (Addgene) (WT-K8-GST ...
-
bioRxiv - Biophysics 2024Quote: The genes encoding for full-length and truncated versions of N-protein (Uniprot: P0DTC9) were PCR-amplified from a vector with the cDNA of N-protein acquired from Addgene (pGBW-m4046785; Plasmid #145684). The CC null mutants in which L223 ...
-
bioRxiv - Cell Biology 2021Quote: ... pGEX6P1-N-HA (Andrew Jackson and Martin Reijns, Addgene 119756) was utilized as the backbone for recombinant protein expression E ...
-
bioRxiv - Cancer Biology 2020Quote: ... N-WASP (#54199) and fascin (#54094) were obtained from Addgene. Each insert was cloned into the lentiviral plasmid pCDH-CMV-MCS-EF1-Puro with GFP fusion protein at C-terminus.
-
bioRxiv - Neuroscience 2020Quote: ... excitatory Gq DREADD (AAV8-hSyn-hM3Gq-mCherry; Addgene; n = 10); and control construct (AAV5-hSyn-EYFP ...
-
bioRxiv - Microbiology 2022Quote: ... derived from a pcDNA3.1-hACE2 vector (Cat. n° 145033, Addgene), was inserted into a pLenti6.3 vector (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2020Quote: ... Fyn was amplified from mEos2-FYN2-N-10 (Addgene 57380) and assembled into pBlueScript with either a mec-4 or osm-10 promoter and the unc-54 3’UTR using the NEBuilder HiFi DNA Assembly kit ...
-
bioRxiv - Genetics 2023Quote: ... for CTCF and mEmerald-RAD21-N-18 (Addgene Plasmid #54248) for RAD21 ...
-
bioRxiv - Molecular Biology 2023Quote: ... H-RASV12 from pBABE-Puro H-RASV12 (n°12545 Addgene) was cloned in a home-made inducible vector derived from pLVX-Tight-Puro (Clontech ...
-
bioRxiv - Molecular Biology 2021Quote: ... pAc5.1C-FLuc-Stop-5BoxB was a gift from Elisa Izaurralde (Addgene plasmid # 21301)30 ...
-
bioRxiv - Biophysics 2021Quote: ... The pET C-terminal TEV His6 cloning vector with BioBrick polycistronic restriction sites (9Bc) was a gift from Scott Gradia (Addgene plasmid #48285 ...
-
bioRxiv - Biochemistry 2020Quote: ... To construct PTP1BPS* and PTP1BPS**, we amplified C-terminal regions of PTP1B (residues 299-405 and 299-435, respectively) from pGEX-2T-PTP1B (Addgene) and used Gibson assembly to join them to the C-terminus of PTP1BPS (50°C for 1 hr ...
-
bioRxiv - Neuroscience 2020Quote: ... The constructs were subcloned using restriction digestion into the pHL-sec vector containing a C-terminal 6xHis-tag (Addgene # 99845). Restriction sites for subcloning were introduced by PCR at the 5’ and 3’ ends of scFv-Clasp heavy and light chains (light chain ...
-
bioRxiv - Biochemistry 2022Quote: ... with an initial Met and a cleavable C- terminal TEV 6x-His tag was a gift from Ginkgo Bioworks (Addgene plasmid 145611 ...
-
bioRxiv - Biochemistry 2022Quote: ... with an initial Met and a cleavable C-terminal TEV 6x-His tag) was a gift from Ginkgo Bioworks (Addgene plasmid 145584 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and LY6C1 (NM_010741.3) were separately cloned into an expression vector backbone with a C-terminal Fc-tag (Addgene plasmid #115773) using Xbal/EcoRV ...
-
bioRxiv - Microbiology 2020Quote: ... or human ACE2 ectodomain (containing a C-terminal His tag) were made according to the E and F sections of the pLKO.1 Protocol from Addgene (http://www.addgene.org/protocols/plko/) ...
-
bioRxiv - Cell Biology 2020Quote: ... of a TubB1 sequence fragment synthesised as a gBlock by Integrated DNA Technologies (IDT) and a C-terminal mApple empty backbone (mApple-C1 was a gift from Michael Davidson (Addgene plasmid # 54631 ...
-
bioRxiv - Biochemistry 2021Quote: ... Vector pREXNH3CA used to clone EfrCD in frame with a C-terminal Avi-tag was constructed from pREXNH3 (Addgene #47079) by PCR amplification with 5’ phosphorylated primers pREXNH3(newAvi_5’P)_FW (5’-aga aaa tcg aat ggc acg aaT AAT AAC TAG AGA GCT CAA GCT TTC TTT GA ...
-
bioRxiv - Synthetic Biology 2021Quote: ... or Omphalotin A (OphA) genes with C-terminal His-tags were cloned into the UTR1-T7RNAP-T500 plasmid backbone (Catalog No. 67739, Addgene). The T7 Max promoter was further cloned into these plasmids for downstream experiments ...
-
bioRxiv - Biochemistry 2023Quote: Restriction-free cloning 30 was used to generate the constructs of MglA-link-MglB with C-terminal hexahistidine tag in pHis17-KanR (mglA-link-mglB-H6, refer Addgene plasmid #78201 for vector backbone ...
-
bioRxiv - Genetics 2023Quote: ... Forward and reverse oligos (CACCGCTGCTGCTGCTGCTGCTGGA and AAACTCCAGCAGCAGCAGCAGC) (IDT) for gRNA 2 were cloned into the BSmBI site of pCbh_v5 AAV-CBE C-terminal (Addgene, # 137176) and pCbh_v5 AAV-CBE N-terminal (Addgene ...
-
bioRxiv - Microbiology 2023Quote: ... encoding the Spike glycoprotein of Wuhan SARS-CoV-2 fused to a C-terminal C9 tag (SW) was a kind gift from Fang Li (Addgene plasmid # 145032 ...
-
bioRxiv - Cell Biology 2024Quote: ... followed by digestion of amplified PCR product with AgeI and NotI and ligation C-terminal to Smo in Smo-mCherry (Addgene plasmid 55134 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... or N- and C-terminal parts were amplified in separate PCR reactions using constructs by Rihtar et al (45) obtained from Addgene (vectors were kind gifts from Roman Jerala ...
-
bioRxiv - Developmental Biology 2024Quote: ... with a C-terminal TwinStrep-tag (IBA LifeScience) joined by a 3xGlyGlyGlySer linker was also inserted into the pHLsec vector (Addgene_99845) between AgeI and KpnI restriction sites ...
-
bioRxiv - Developmental Biology 2024Quote: ... with a C-terminal TwinStrep-tag (IBA LifeScience) joined by a 3xGlyGlyGlySer linker was inserted into the pHLsec vector (Addgene_99845) between AgeI and KpnI restriction sites ...
-
bioRxiv - Cancer Biology 2022Quote: ... pCDNA3-V5-PTPN14-wild type was a gift from Jianmin Zhang (Addgene plasmid # 61003 ...
-
bioRxiv - Neuroscience 2024Quote: Adeno-associated virus (AAV) type 2 carrying cre-dependent ChR2-eYFP (Addgene plasmid 20298 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The type V Scytonema hofmanni (Sh)CAST was obtained from Addgene (#127922) [15] ...
-
bioRxiv - Immunology 2023Quote: ... N-MLV reporter viruses were generated by transfection of a three-plasmid system: pCIG3-N for expression N-MLV gag/pol (Addgene #132941, a gift from Jeremy Luban) [50] ...
-
bioRxiv - Molecular Biology 2020Quote: ... A C-terminal Strep tag on ORF24-NTD was added by inverse PCR to generate p6H-SUMO3-ORF24-NTD-Strep (Addgene #138467).
-
bioRxiv - Molecular Biology 2020Quote: ... Full-length UL87 was PCR amplified from HCMV Towne BAC DNA with primers to introduced EcoRI and XhoI sites and cloned into pcDNA4/TO-2xStrep (C-terminal tag) using T4 DNA ligase (Addgene #138434). Full-length mu24 was PCR amplified from MHV68-infected 3T3 cell cDNA with primers to introduce BamHI and NotI sites and cloned into pcDNA4/TO-2xStrep (C-terminal tag ...
-
bioRxiv - Cell Biology 2020Quote: ... obtained from Dharmacon) into pUAST vectors containing a C-terminal Venus open reading frame (Wang et. al, 2012, Addgene plasmid 35204). Transgenes were sequenced and then injected into embryos containing an attP8 site on the X chromosome (BDSC stock #32233 ...
-
bioRxiv - Cell Biology 2020Quote: ... containing human ATF6 cDNA fused to mCerulean on the C-terminal side of ATF6 was generated by amplifying ATF6 ORF from pEGFP-ATF6 (Addgene #32955) by PCR using the following primers ...
-
bioRxiv - Genetics 2021Quote: ... or the catalytic domain (CD) of mouse Dnmt3a and the C-terminal part of mouse Dnmt3L (3a3L) (amplified from pET28-Dnmt3a3L-sc27 (Addgene #71827)) and cloned in PiggyBac plasmids under control of the TRE3G promoter ...
-
bioRxiv - Bioengineering 2021Quote: ... nanobody sequences were PCR amplified with primers containing terminal regions of homology for cloning into a pRset plasmid (Addgene plasmid 3991)(Invitrogen ...
-
bioRxiv - Biochemistry 2020Quote: ... Monobody HA4 or OptoMB variants were PCR amplified and Gibson-assembled from bacterial plasmids (described above) into a pHR vector with a C-terminal irFP fusion (Addgene #111510). The SH2 domain was amplified from EZ-L664 using PCR ...
-
bioRxiv - Cell Biology 2021Quote: ... codon optimized coding sequences with a C-terminal HA epitope tag were synthesized by IDT and cloned into a pCW57.1 (Addgene plasmid #41393) derived lentiviral vector with a blasticidin resistance gene (replacing the original puromycin resistance gene) ...
-
bioRxiv - Cell Biology 2021Quote: Plasmids for the FRET-aggregation reporters were generated by subcloning full length human α-synuclein PCR-amplified from pCAGGS-aSyn-CFP (a gift from Robert Edwards and Ken Nakamura)39 to the C-terminal Clover2 or mRuby2 into the lentiviral expression vector pMK1200 (Addgene #84219)21 under the control of the constitutive EF1A promoter ...
-
bioRxiv - Cancer Biology 2021Quote: Previously described pMIG-Aalpha WT retroviral vector with a Flag-tag at the NH2 terminal (32) obtained from Addgene (plasmid #10884) was generously provided by William Hahn ...
-
bioRxiv - Biochemistry 2022Quote: ... DNA encoding peptides derived from the C-terminal last 10 residues of the norovirus and cellular proteins were cloned into the pET-His-GST vector (Addgene:29655) with an N-terminal GST tag ...