Labshake search
Citations for Addgene :
401 - 450 of 10000+ citations for Human MMP24 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2022Quote: ... The plasmid pLp3050sNuc (Addgene plasmid # 122030) [30] was used as the vector backbone for the recombinant plasmids generated in this study ...
-
bioRxiv - Neuroscience 2023Quote: ... one plasmid (px458, Addgene Plasmid #48138) expressing sgRNA as well as Cas9 was used to introduce double-strand-breaks near Exon 7 of SMN2 locus ...
-
bioRxiv - Biochemistry 2023Quote: ... The plasmids pCytERM_mScarlet_N1 (Addgene Plasmid # 85066), pC1-HyPer-Red (Addgene Plasmid # 48249) ...
-
bioRxiv - Bioengineering 2022Quote: The pRG2 plasmid (Addgene plasmids #104174) was used for gRNA cloning and pU6-pegRNAGG-acceptor (Addgene plasmids #132777) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Plasmids lentiCas9-Blast (Addgene plasmid 52962), pMD2.G (Addgene plasmid 12259) ...
-
bioRxiv - Cell Biology 2023Quote: ... BANF1 plasmid (pBAF plasmid Addgene #104152) was transformed into E ...
-
bioRxiv - Cancer Biology 2023Quote: ... plentiCRISPRv2-Blast plasmid (Addgene: Plasmid #83480), which contains the Cas9 coding sequence and a cloning site for sgRNA ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and plasmid pEcgRNA (Addgene Plasmid #166581) contains spectinomycin resistance ...
-
bioRxiv - Molecular Biology 2024Quote: ... plasmid F11R pEBio (Addgene plasmid #61486) was modified by moving the 726bp region isolated by digestion ...
-
bioRxiv - Genetics 2019Quote: sgRNAs targeting human ADCK4 (sgRNA1: GCTGCACAATCCGCTCGGCAT, sgRNA2: GTAAGGTCTGCACAATCCGCT, and sgRNA3: GACCTTATGTACAGTTCGAG,) were cloned into BsmBI-digested lentiCRISPR v2 (Addgene plasmid #52961). ADCK4 cDNA was cloned into the p3xFLAG CMV26 (C-terminal ...
-
bioRxiv - Neuroscience 2020Quote: ... was cloned into a rAAV vector under the human synapsin promoter using the plasmid pAAV-hSyn-EGFP (gift from Bryan Roth; Addgene, #50465) as backbone and removing EGFP ...
-
bioRxiv - Neuroscience 2020Quote: UAS-SMARCA1 construct: Flies carrying UAS-SMARCA1WT were generated using human SMARCA1 cloned into the pFastBac Dual vector (Addgene plasmid #102243). Gateway cloning (Invitrogen ...
-
bioRxiv - Neuroscience 2020Quote: ... with a pEGFP-C1 mammalian vector containing full length human A53T variant αSyn with a fusion EGFP tag (Addgene, Plasmid #40823), following the manufacturer’s protocol ...
-
bioRxiv - Genetics 2021Quote: ... uracil glycosylase inhibitor (UGI) and 3’UTR of human ATP5B was amplified from the published DdCBE construct (Addgene plasmid no. 157843). The PCR product was digested with the restriction enzymes XbaI and EcoRI ...
-
bioRxiv - Biochemistry 2020Quote: Human ATAD2/B cDNA (UniProt codes Q9ULIO and Q6PL18) was a gift from Nicole Burgess-Brown (Addgene plasmid # 38916 and 39046)7 ...
-
bioRxiv - Immunology 2020Quote: ... Human orfeome clone 10217) was gateway cloned into an attR-destination vector encoding an N-terminal FLAG tag (Addgene, Plasmid #18700), with the Gateway™ LR Clonase™ II Enzyme mix (ThermoFisher ...
-
bioRxiv - Neuroscience 2020Quote: ... TH-Cre hPSC cells (passage were transduced with a lentiviral construct under control of the human TH-Cre promoter (Addgene, plasmid # …..). The cells were transduced at a multiplicity of infection (MOI ...
-
bioRxiv - Cancer Biology 2022Quote: The human NOTCH 1 intracellular domain (h1NICD) doxycycline-inducible expression plasmid (pLIX-h1NICD) was a gift from Julien Sage (Addgene #91897)11 ...
-
bioRxiv - Cell Biology 2019Quote: ... Human N-WASP GBD domain was PCR amplified from pCS2-mRFP-GBD (a kind gift from William Bement, Addgene plasmid 26733) with XhoI/AscI flanking restriction sites and cloned into pET-pmKate2 to generate mKate-GBD ...
-
bioRxiv - Immunology 2020Quote: ... Human G3BP1 cDNAs with or without stop codon were amplified by PCR from pN1/G3BP1-iRFP (Okada lab plasmids, Addgene #129339) with the sense primer 5′ -GCCAGATCTATGGTGATGGAGAAGCCTAG-3′ and the antisense primers 5′ -GCCGAATTCGGATCCTTACTGCCGTGGCGC-3′ or 5′ -GCCGAATTCGGATCCCTGCCGTGGCGCAAG-3′ ...
-
bioRxiv - Immunology 2021Quote: ... A549ACE2 cells were generated using lentiviral transduction of a human ACE2 cDNA expressing plasmid (backbone: pLV-EF1a-IRES-Puro (Addgene 85132) as previously described [31] ...
-
bioRxiv - Neuroscience 2021Quote: Full-length human APLP1 gene with a Flag tag in the N-terminal was cloned from pCAX APLP1 (Addgene plasmid#30141) and the primers were shown in Key Resources Table (NheI-Flg-hAPLP1-F/XhoI-His-hAPLP1-R) ...
-
bioRxiv - Cancer Biology 2021Quote: ... TERT+ cells were transiently transfected with human CA-FOXO1 (pcDNA3 Flag FKHR AAA mutant; gift from Kunliang Guan; Addgene plasmid # 13508) using polyethyleneimine ...
-
bioRxiv - Cell Biology 2022Quote: ... REEP1-mEmerald and REEP1-mCherry plasmids were generated by inserting a codon-optimized human REEP1 gblock into mEmerald-N1 (gift from M. Davidson; Addgene #53976) or mCherry-N1 backbones (Clontech) ...
-
bioRxiv - Neuroscience 2023Quote: ... Human Synapsin1 promoter and smFP-HA were PCR amplified from pAAV-hSyn-EGFP (a gift from Bryan Roth, Addgene Plasmid #50465) and pCAG_smFP-HA (a gift from Loren Looger ...
-
bioRxiv - Microbiology 2022Quote: To make human ACE2 protein, pcDNA3-sACE2-WT(732)-IgG1 (Chan et al., 2020) (Addgene plasmid #154104, gift of Erik Procko) plasmid was transfected into Expi293 cells using PEI at a ratio of 1:3 ...
-
bioRxiv - Biochemistry 2023Quote: ... Human ATAD2B bromodomain-containing protein (residues 953−1085, Uniprot code: Q9ULI0) was a gift from Nicole Burgess-Brown (Addgene plasmid # 39046) was PCR-amplified and cloned into pDEST15 (GlaxoSmithKline ...
-
bioRxiv - Cancer Biology 2023Quote: ... the double-stranded oligonucleotide sgRNAs for human FOXM1 sequences were ligated into the BbsI sites of the FgH1tUTG plasmid (Addgene, #70183). sgRNA target sequences were listed in Supplementary Table 2 ...
-
bioRxiv - Cell Biology 2023Quote: ... The sgRNA was generated by annealed oligo cloning into a chimeric human codon-optimized SpCas9 and pU6-driven guide RNA expression plasmid (pX330, Addgene #42230) with BbsI digestion (see table S8 for protospacer sequence) ...
-
bioRxiv - Evolutionary Biology 2023Quote: Full-length human GLI3 and mouse Gli3 cDNAs were obtained from pEGFPC3-hGli3 (a gift from Aimin Liu, Addgene plasmid, (57)) and pCMV-Gli3-Myc-DDK (ORIGENE ...
-
bioRxiv - Cancer Biology 2022Quote: ... A MYC T58A gene (synthesized by IDT, Coralville, USA, using the human MYC T58A sequence as template from Addgene plasmid # 18773) [69] ...
-
bioRxiv - Developmental Biology 2023Quote: An enhanced piggyBac Puromycin selectable and DOX inducible vector was digested with EcoRI-NotI and ligated with PCR-amplified human SOX2 from the FUW-tetO-hSOX2 plasmid (Addgene#20724). Transfection into hPSCs was done using Lipofectamine Stem Reagent per the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... (NM_004458) Human Tagged ORF Clone (cat# RC205356) plasmids and cloned into a 3rd generation lentiviral vector PLJM1-EGFP (Addgene, cat# 19319). The control and ERBB2 OE cells were generated using retroviral vectors pBABE-puro (Addgene ...
-
bioRxiv - Cancer Biology 2023Quote: ... from the expression vector pcDNA3.1/Myc-His(-)-HSulf-2 bearing human Sulf-2 cDNA (a gift from Steven Rosen, Addgene plasmid # 13004) (Morimoto-Tomita et al. ...
-
bioRxiv - Biophysics 2020Quote: ... psPAX2 packaging plasmid (plasmid #12260) and pMD2.G envelope plasmid (plasmid #12259) were from Addgene (Watertown, MA). N-terminally Cy5-labeled peptides were synthesized and purified to > 95% purity by Gen-Script (Piscataway ...
-
bioRxiv - Bioengineering 2023Quote: ... each well received the following plasmids: ZipGFP-Casp3 plasmid (Addgene plasmid #81241) and pcDNA3-PpC_TRIM8_# ...
-
bioRxiv - Cell Biology 2020Quote: ... Lentivirus production and shRNA knockdown were performed according to protocols from Addgene (www.addgene.org/tools/protocols/plko/).
-
bioRxiv - Molecular Biology 2023Quote: shRNA sequence targeting TAL1 3’UTR (CATAACCACTGAAGGGAAT) was cloned to Tet-pLKO-puro vector (Addgene #8453). For lentivirus production ...
-
bioRxiv - Genetics 2023Quote: ... and the annealed sense and antisense shRNA oligonucleotides were cloned into pLKO.1-puro vector (Addgene) for knockdown of human KISS1 ...
-
bioRxiv - Genomics 2022Quote: ... HEK-293T cells were transfected with shRNA constructs and lentiviral packaging constructs pMD2.G (Addgene #12259) and psPAX2 (Addgene #12260) ...
-
bioRxiv - Developmental Biology 2023Quote: Lentiviral shRNA expression constructs were generated by first modifying the pLKO.1 puro vector (Addgene #8453), digesting with BamHI and KpnI and replacing the puromycin resistance cassette with an mCherry coding sequence.
-
bioRxiv - Genetics 2021Quote: ... digested hSTARR-ORI plasmid (Addgene plasmid #99296) with NEBuilder HiFi DNA Assembly Master Mix (NEB) ...
-
bioRxiv - Genomics 2020Quote: ... phaffii expression plasmid PP164 (Addgene plasmid #78988); the resulting DNMT3L expression cassette driven by a ppTEF1 promoter was then cloned using Gibson Assembly into each of the constructs expressing single DNMTs described above (Supplementary Table S1) ...
-
bioRxiv - Genomics 2021Quote: ... a packaging plasmid (psPAX2: Addgene plasmid # 12260), and each individual MFN2 expression plasmid in a mass ratio of 0.5/1/0.5 for a total of 2µg ...
-
bioRxiv - Cell Biology 2021Quote: ... psPAX plasmid (Addgene, Watertown, MA, plasmid 12260) and pMD2.G plasmid (Addgene ...
-
bioRxiv - Cancer Biology 2021Quote: ... pENTR1A no ccdB plasmid (Addgene plasmid # 17398) was received by Dr ...
-
bioRxiv - Cell Biology 2021Quote: ... The EGFP-RILP plasmid (Addgene plasmid #110498) (Mainou and Dermody 2012 ...
-
bioRxiv - Cancer Biology 2020Quote: ... digested hSTARR-ORI plasmid (Addgene plasmid #99296) with NEBuilder HiFi DNA Assembly Master Mix (NEB) ...
-
bioRxiv - Cell Biology 2021Quote: ... The psPAX2 plasmid (#842, Addgene plasmid #12260) encodes the packaging system ...
-
bioRxiv - Molecular Biology 2021Quote: ... or VSV-G plasmid (Addgene plasmid # 8454) as glycoprotein ...