Labshake search
Citations for Addgene :
501 - 550 of 10000+ citations for Human MMP24 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... a construct encoding a human codon-optimized Cas9 (hCas9) with an NLS at its C-terminus (a gift from George Church, Addgene plasmid #41815) (Mali et al. ...
-
bioRxiv - Systems Biology 2022Quote: ... The nuclear marker H2B-miRFP703 is a fusion of the human H2B clustered histone 11 (H2BC11) with the monomeric near-infrared fluorescent protein miRFP703 (Shcherbakova et al. 2016) (Addgene plasmid #80001). ERK-KTR-mRuby2 ...
-
bioRxiv - Neuroscience 2020Quote: ... pLenti c-Jun was created by cloning human c-Jun from PMIEG3-c-Jun (a gift from Alexander Dent (Addgene plasmid #40348)[50] using BAMHI and XHOI into pLenti-puro (a gift from Ie-Ming Shih (Addgene plasmid #39481 ...
-
bioRxiv - Biochemistry 2022Quote: ... Plasmid pX330 for expression of human-codon-optimized Streptococcus pyogenes (Sp) Cas9 and chimeric guide RNA were obtained from Addgene (Cambridge, MA). The seed sequence for the SpCas9 target site in the target gene was tcggtgcagaccacctcccgcgg (underline ...
-
bioRxiv - Biochemistry 2021Quote: DNA encoding human RTCB (Uniprot Q9Y3I0) was inserted using ligation-independent cloning into the UC Berkeley MacroLab 438B vector (Addgene plasmid #55219) and DDX1 (Uniprot Q92499) ...
-
bioRxiv - Biochemistry 2021Quote: DNA encoding amino acids Phe2-Asp101 of human CGI-99 was cloned into the UC Berkeley MacroLab 1B vector (Addgene plasmid # 29653). The fusion protein containing an N-terminal His6 tag and a TEV protease cleavage site was expressed in BL21 (DE3 ...
-
bioRxiv - Immunology 2021Quote: ... The S106C mutant of human ASC PYD (aa1-106) was cloned into an in-house modified pET28-MBP-TEV vector (Addgene, plasmid #69929), in which N-terminal His6 tag was added for expression of proteins with a cleavable N-terminal His6-MBP-tag ...
-
bioRxiv - Molecular Biology 2021Quote: ... A pX330 plasmid for expression of the human codon-optimized Streptococcus pyogenes (Sp) Cas9 and chimeric guide RNA was obtained from Addgene (Cambridge, MA). The seed sequences for the SpCas9 target site in target genes are shown in Table S2 ...
-
bioRxiv - Cell Biology 2022Quote: ... were constructed by cloning the open reading frame (ORF) of human IRF1 or cMYC into a modified pLX303 vector (Addgene plasmid 25897). cDNAs encoding IRF1-SBDmut ...
-
bioRxiv - Genetics 2022Quote: ... in vitro transcription assays for human POU6F2 was performed using a reporter plasmid that encodes DsRed under a Hes5 promoter (Addgene, Cat# 26868). For POU6F2 expression vectors ...
-
bioRxiv - Neuroscience 2023Quote: ... A human Sirt3-RFP driven by the CaMKII promoter was constructed through PCR of the human Sirt3 sequence from Sirt3-FLAG (Addgene plasmid 13814)5 into the BamHI and AgeI sites of CaMKII-MICU3-RFP plasmid6 resulting in the linker sequence RPVVA joining Sirt3 and RFP sequences.
-
bioRxiv - Cell Biology 2023Quote: ... pDsRed-RAB11A WT (for expression of a fluorescently-tagged, wild-type version of RAB11A in human cells) was obtained from Addgene (plasmid 12679). For expression of GFP-HEATR5B from baculovirus ...
-
bioRxiv - Genetics 2023Quote: ... FlpOM was generated by introducing the human b-globin intron from CreM into a codon optimized Flp (Raymond and Soriano, 2007; Addgene plasmid # 13792), interrupting the coding sequence between amino acids 159 and 160 ...
-
bioRxiv - Cancer Biology 2024Quote: ... the Human GeCKOv2 CRISPR Knockout Pooled Library (A+B) in the lentiGuide-Puro vector backbone (gift from Feng Zhang; Addgene Plasmid # 1000000048) was amplified and purified as directed by Addgene ...
-
bioRxiv - Genomics 2019Quote: ... the gRNA expression plasmid AX03_pgEGFP and the hCas9 nuclease plasmid (Addgene plasmid 41815) were used for generating DSBs at the EGFP sequence ...
-
bioRxiv - Genetics 2019Quote: ... the same amount of each sgRNA plasmid with pCas9 plasmid (Addgene plasmid #42876) were co-transfected into HEK293T cells using ViaFect™ transfection reagent (Promega ...
-
bioRxiv - Neuroscience 2023Quote: ... plasmid or a pU6-(BbsI)_CBh-Cas9-T2A-mCherry plasmid (Addgene plasmid #64324) according to the method published by Ran et al ...
-
bioRxiv - Neuroscience 2024Quote: The assembled pAAV plasmids with the AAV helper plasmid (pAdDeltaF6; Addgene plasmid # 112867) and pAAV2/2 (for AAV2 ...
-
bioRxiv - Cancer Biology 2022Quote: ... human E2F5 and human DP1 were purchased from Addgene, whereas the ORF encoding human p130 from Origene.
-
bioRxiv - Cell Biology 2020Quote: ... shRNA for LacZ (negative control) and MYC were generate according to the pLKO.1 protocol from Addgene. Cignal 45-pathway reporter arrays ...
-
bioRxiv - Cell Biology 2022Quote: ... HEK293 cells were transfected with 4µg shRNA p53-puromycin (Fachinetti Lab) + 4µg pMD2.G (12259 from Addgene, RRID:Addgene_12259) + 4µg psPAX2 (12260 from Addgene ...
-
bioRxiv - Cancer Biology 2021Quote: The inducible BCL6 shRNA vectors were generated based on a pLVX-TetOne-Puro vector (RRID: Addgene 124797) according to standard protocols ...
-
bioRxiv - Cell Biology 2022Quote: ... Small hairpin RNAs (shRNA) targeting sequences for specific genes were cloned in pLKO.1-Puro vector (Addgene). Upon production by 293T cells ...
-
bioRxiv - Cancer Biology 2023Quote: shRNA sequences targeting LINE-1 ORF169 were cloned into pLKO.1-TRC cloning vector (Addgene, cat# 10878) using EcoR1 and AgeI restriction enzyme digestion ...
-
bioRxiv - Molecular Biology 2023Quote: shRNA oligonucleotides targeting FEN1(shown in the following table) were cloned into pLKO.1 (Cat# 8453, Addgene) digested with EcoRI and AgeI ...
-
bioRxiv - Biochemistry 2023Quote: Lentiviral vector pLH3 was constructed by replacing the U6 promoter in pLKO.1 GFP shRNA (Addgene #30323) with the CMV promoter in pKH3 (Addgene #12555 ...
-
bioRxiv - Neuroscience 2021Quote: ... the plasmid carrying spike protein sequence (Miaoling Plasmid Sharing Platform plasmid #P18156) was co-transfected with psPAX2 (Addgene plasmid #12260) into HEK293T cell line using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Genomics 2023Quote: The plasmids encoding PE2 (Plasmid#132775) as well as the plasmid for expressing the pegRNA (Plasmid #132777) were obtained from Addgene. PegRNAs were cloned into the plasmid backbone with paired oligonucleotides (IDT ...
-
bioRxiv - Neuroscience 2024Quote: ... were obtained from Addgene (Tet-O-Fuw-Ascl1 Addgene plasmid #27150, pLV.PGK.mLmx1a Addgene plasmid #33013, Nurr1 Addgene plasmid #35000, FUW-M2rtTA Addgene plasmid #20342). The cassette with the three human transcription factors hALAN – human ASCL1 ...
-
bioRxiv - Cell Biology 2023Quote: To make plasmid encoding inducible E2F2: The FUW-tetO-hOKMS plasmid (plasmid #51543; Addgene) was cut with EcoR1 to linearize it and remove the original OKMS insert ...
-
bioRxiv - Cell Biology 2020Quote: ... The plasmid encoding mApple-Rab7a (Addgene plasmid #54945) was a gift from Michael Davidson (Florida State University).
-
bioRxiv - Biophysics 2022Quote: ... 7.5 µg packaging plasmid psPAX2 (Addgene plasmid #12260) and 2.5 µg envelope plasmid pMD2.G (Addgene plasmid #12259 ...
-
bioRxiv - Genomics 2019Quote: ... and cloned into pX458 plasmid (Addgene plasmid #48138) using ClonTech In-Fusion Cloning kit ...
-
bioRxiv - Bioengineering 2019Quote: The plasmid pET28a_T7-ARG1 (Addgene plasmid no. 106473) was transformed into BL21(A1 ...
-
bioRxiv - Developmental Biology 2019Quote: ... and CAG::GFP plasmid backbone (Addgene plasmid #107281). PCR-amplified regions and InFusion junctions were verified by sequencing ...
-
bioRxiv - Molecular Biology 2019Quote: ... the FLAG-TPR-pcDNA3.0 plasmid (Addgene plasmid # 60882) (61 ...
-
bioRxiv - Cancer Biology 2019Quote: ... packaging plasmids pCMV-VSV-G46 (Addgene plasmid #8454) and pCMV-dR8.2 dvpr46 (Addgene plasmid #8455 ...
-
bioRxiv - Genomics 2021Quote: ... using an envelope plasmid (pVSVg: Addgene plasmid # 8454), a packaging plasmid (psPAX2 ...
-
bioRxiv - Neuroscience 2021Quote: Plasmids used were pCAG-GFP (Addgene, plasmid #11150), pCAG-Nrp1 (gift from Prof ...
-
bioRxiv - Neuroscience 2021Quote: ... The plasmid was obtained from Addgene (Plasmid#26971) and packaged by Vigene after in house plasmid preparation ...
-
bioRxiv - Cancer Biology 2021Quote: ... and envelope plasmid pMD2.G (Addgene plasmid # 12259) (both were a gift from the Trono lab) ...
-
bioRxiv - Microbiology 2020Quote: ... Plasmid pBbS8k-RFP (obtained from Addgene, Plasmid #3527652) was used as vector and amplified by primers AS_328 ...
-
bioRxiv - Microbiology 2021Quote: ... 100 ng of plasmid plRL19 (Addgene plasmid #163634) was also added ...
-
bioRxiv - Cell Biology 2021Quote: ... The pMD2.G plasmid (#554, Addgene plasmid #12259) encodes the envelope of lentivirus ...
-
bioRxiv - Cancer Biology 2021Quote: ... inducible CRISPR/Cas9 plasmid TLCV2 (Addgene plasmid #87360) with UHRF1 gRNA (gRNA1 sequence ...
-
bioRxiv - Neuroscience 2022Quote: ... MQ1 and MQ1Q147L plasmids (Addgene plasmid #89634, 89637) and sgRNAs were co-transfected into DA neurons with Lipofectamine Stem (Invitrogen ...
-
bioRxiv - Cancer Biology 2022Quote: ... Lentiviral plasmids included the packaging plasmid psPAX2 (Addgene plasmid # 12260 ...
-
bioRxiv - Cancer Biology 2022Quote: ... pUltra-Chili-Luc vector plasmid (Addgene plasmid #48688), together with packaging (psPAX2 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and pMD2.G packaging plasmids (Addgene, Plasmid #12259) using X-treme GENE 9 DNA transfection reagent (Roche ...
-
bioRxiv - Molecular Biology 2020Quote: ... Plasmids pcDNA4/TO-ORF18-2xStrep (Addgene plasmid #120372), pcDNA4/TO-ORF24-2xStrep (Addgene plasmid #129742) ...