Labshake search
Citations for Addgene :
401 - 450 of 2293 citations for 8 chloro 10 3 dimethylamino propyl phenothiazin 1 ol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2020Quote: ... The pRPC-oscillator plasmid is based on pZS1-lTlrLLtCL [3] (Addgene #26489) with the dCas9 gene taken from pdCas9-bacteria [18] (Addgene #44249) ...
-
bioRxiv - Cell Biology 2019Quote: ... Thermo Fisher Scientific) or scrambled control (5’-CCTAAGGTTAAGTCGCCCTCG-3’, Addgene Plasmid #26701). Viral particles were produced from 293FT cells by co-transfection with viral vectors ...
-
bioRxiv - Immunology 2021Quote: ... EMTP-3×GFP was a gift from William Bement (Addgene plasmid # 26741). Histone 2B-GFP was a gift from Geoff Wahl (Addgene plasmid # 11680) ...
-
bioRxiv - Cell Biology 2022Quote: ptf-Galectin-3 was a gift from Tamotsu Yoshimori (Addgene plasmid # 64149) (Maejima et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... an Fmr1 exon 3 DNA oligonucleotide was inserted into pLentiCRISPR (Addgene, 49535) adapted from published methods [12] ...
-
bioRxiv - Cancer Biology 2023Quote: ... and Isoform 3 constructs were cloned into a pMSCV puro backbone (Addgene) and packaged into retrovirus using Phoenix-AMPHO producer cells (ATCC) ...
-
bioRxiv - Genetics 2022Quote: ... 500 ng/ul pBac[3xP3-EGFP;Tc’hsp5’-Gal4Delta-3’UTR] (Addgene #86449), 80 ng/ul Of-v gRNA described above (see “CRISPR/Cas9 mutagenesis of Of-vermilion”) ...
-
bioRxiv - Cancer Biology 2023Quote: PC-3 cells were transfected with Emerin-pEGFP-C1 (Addgene plasmid #61993). Forty-eight hours post-transfection cells were cultured in medium containing G-418 (400Lμg/ml ...
-
bioRxiv - Cell Biology 2023Quote: ... 3) pMXs-IP-EGFP-mATG5 was a gift from Noboru Mizushima (Addgene plasmid #38196 ...
-
bioRxiv - Molecular Biology 2024Quote: ... pCS2-nCas9n-nanos 3’UTR was a gift from Antonio Giraldez (Addgene plasmid # 62542 ...
-
bioRxiv - Neuroscience 2024Quote: ... we bilaterally injected RetroAAV-hSyn-Cre (500nL, Addgene Lot v70508, 3*1013) into the LS ...
-
bioRxiv - Developmental Biology 2024Quote: ... 3 μg of episomal pCXLE-Sox2A61V-2A-Klf4-2A-Myc (Addgene #210017) and 3 μg of pCXWB-EBNA1 (Addgene #37624 ...
-
bioRxiv - Cancer Biology 2024Quote: ... SEPSECS: 5’-AACCGCGAGAGCTTCGCGG-3’ were cloned into lentiCRISPRv2 vector (Addgene, Plasmid #52961) using BsmBI restriction sites ...
-
bioRxiv - Neuroscience 2019Quote: ... AAV5 CaMKII-hM3Dq-IRES-mCitrine (3.75×10^14 or 3.75×10^13 virus molecules/mL) (Addgene plasmid #50466 ...
-
bioRxiv - Genetics 2022Quote: ... The plasmid encoding the sgRNA n°8 used in this study is available on Addgene (BPK1520-sgRNA GLB1, Addgene #184378).
-
bioRxiv - Systems Biology 2019Quote: ... the cells were transfected with a mix of 8 µg lentiviral lentiCRISPRv2 vector containing the TKOv3 gRNA library (Addgene #90294) (Hart et al ...
-
bioRxiv - Pathology 2021Quote: ... of adeno-associated virus serotype 8 encoding Cre recombinase under the hepatocyte-specific thyroid binding globulin promoter (AAV8-TBG-Cre) (Addgene) followed by a 12 days (12d ...
-
bioRxiv - Cell Biology 2020Quote: ... HEK293T cells were transfected using calcium phosphate method with 4-6 µg plasmid DNA and 8 µg of each pMD2.G and psPAX2 (Addgene). After 48 h ...
-
bioRxiv - Systems Biology 2023Quote: ... Lentiviruses were packaged according to the following protocol: Shuttle plasmid (8 μg), psPAX2 packaging vector (2 μg, a gift from Didier Trono (Addgene plasmid #12260 ...
-
bioRxiv - Neuroscience 2023Quote: ... DAT-Cre+/- / SERT-Flp+/- mice were injected with 500 nL of either AAV-DJ-ef1a-DIO-ChR2-eYFP or AAV-DJ-ef1a-DIO-eYFP bilaterally into the VTA and 1000 nL of AAV-8-nEF-CoffFon-NpHR3.3-eYFP (Addgene #137154) or AAV-DJ-ef1a-fDIO-eYFP into the DR and implanted bilaterally with optical fibers in the NAc medSh ...
-
bioRxiv - Cell Biology 2022Quote: ... The sgRNA expression vectors were generated by cloning appropriate DNA oligonucleotides (Suppl. Table 8) in the BbsI restriction sites of pX459 (#62988, Addgene). In brief ...
-
bioRxiv - Neuroscience 2023Quote: AAV serotype 8 viral vectors encoding for floxed EGFP under the synapsin promoter (pAAV-hSyn-DIO-EGFP (#50457)) were purchased from Addgene. rAAV-PV-EGFP-bGH polyA and rAAV-PV-CRE-EGFP-bGH polyA encoding for EGFP under the PV promoter were purchased from BrainVTA ...
-
bioRxiv - Biochemistry 2024Quote: ... AriB or AriA-AriB were cloned into an arabi-nose-inducible UC Macrolab vector 8-B (Addgene #37502; ampicillin-resistant) and Ocr was cloned into an IPTG-inducible pTrc99A-based vector (kanamycin-resistant) ...
-
bioRxiv - Neuroscience 2022Quote: ... P0-1 pups received the viral construct AAV9-hSyn-hChR2(H134R)-EYFP (200 µl at titer ≥ 1×10¹³ vg/mL, #26973-AAV9, Addgene, MA, USA) into the OB and the retrograde virus AAVrg-CamKIIα-mCherry (80 µl at titer ≥ 7×10¹² vg/mL ...
-
bioRxiv - Microbiology 2022Quote: Individual guide RNA (gRNA) sequences (Supplemental Table 1) were cloned into BsmBI-digested lentiCRISPRv2 (Addgene #52961, a gift from Feng Zhang [10]) and resulting lentiviral stocks prepared as previously described [11] ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 10 µg of psPAX2 (Addgene) and SARS-CoV-2-S variant (pCDNA 3.1_Spike_Del19 ...
-
bioRxiv - Cell Biology 2019Quote: ... mVenus-VE-Cadherin-N-10 (Addgene plasmid # 56340 ...
-
bioRxiv - Cell Biology 2020Quote: ... packaging (10 μg psPAX2, Addgene #12260), and envelope (6 μg pMD2.G ...
-
bioRxiv - Cell Biology 2021Quote: ... mEmerald-actin-N-10 (Addgene #53979), mEmerald-actin-C-18 (Addgene #53978) ...
-
bioRxiv - Cell Biology 2020Quote: ... mCardinal-H2B-C-10 (Addgene #56162)11 ...
-
bioRxiv - Bioengineering 2023Quote: ... and pVSV-g (10 μg) (Addgene plasmid #132776 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 10 µg psPAX2 (Addgene, Plasmid #12260), and 4.33 µg pMD2.G (Addgene ...
-
bioRxiv - Cell Biology 2023Quote: ... and 10 μg psPAX2 (Addgene #12260)) along with 10 μg lentiviral plasmid with lipofectamine 3000 (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2024Quote: ... 10 µg LentiCRISPRv2-opti (Addgene #163126) was digested and dephosphorylated for 3 hours in a 60 µL reaction at 37 °C with FastDigest Esp3I and FastAP (ThermoFisher FD0454 and EF0654 ...
-
bioRxiv - Cell Biology 2023Quote: ... pHAGE-TEX264-GFP (Addgene 201925 10); pHAGE-TEX264(deltaLIR,F273A)-GFP (Addgene 201926 10) ...
-
bioRxiv - Microbiology 2022Quote: ... pLenti-X2-Zeo-DEST (749-3) [a gift from Eric Campeau (Addgene, 21562)] and the donor vector ...
-
bioRxiv - Cell Biology 2019Quote: ... pCIG3 (pCMV-IRES-GFP version 3) was a gift from Felicia Goodrum (Addgene plasmid # 78264 ...
-
bioRxiv - Cancer Biology 2020Quote: ... sgFLI_Ex9 (5’-GCCTCACGGCGTGCAGGAAG-3’) was cloned into lentiCRISPR v2-Blast vector (Addgene, #83480) using BsmbI restriction sites ...
-
bioRxiv - Cell Biology 2020Quote: ... pDD162 (Peft-3::Cas9 + Empty sgRNA) was a gift from Bob Goldstein (Addgene plasmid # 47549 ...
-
bioRxiv - Biophysics 2020Quote: ... and a guide RNA/Cas9 plasmid pX330 human 3’ HP1α gRNA (Addgene 127907) with Lipofectamine 2000 according to manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... a p21 sgRNA (5’-GATTGCGATGCGCTCATGGC-3’) was cloned into the px330 vector (Addgene). ESCs were co-transfected with 2μg of this vector and 0,12μg of an hygromycin marker (#631625 ...
-
bioRxiv - Biochemistry 2021Quote: ... The pcDNA 3-CDK9 HA plasmid was purchased from Addgene (ID 14640, RRID:Addgene_14640), which was originally established by Dr Matija Peterlin (43) ...
-
bioRxiv - Neuroscience 2022Quote: ... unique sgRNA (5’-CACCGGGACATAGTATTTGAAAGAC-3’) was cloned into lenti-CRISPRv2 construct (Addgene #52961), which expresses Cas9 and puromycin cassette ...
-
bioRxiv - Neuroscience 2022Quote: A viral cocktail containing AAV2/5.GfaABC1D GCaMP6f (3 × 1012 gc/ml, Addgene) for astrocyte Ca2+ detection or AAV9.hSyn.GCaMP6f (3 × 1012 gc/ml ...
-
bioRxiv - Cell Biology 2020Quote: ... pDD162 (Peft-3::Cas9 + Empty sgRNA) was a gift from Bob Goldstein (Addgene plasmid # 47549 ...
-
bioRxiv - Cell Biology 2021Quote: ... the Cas9-expression plasmid pDD162 (Peft-3::Cas9, 50 ng/μL, Addgene #47549) (Dickinson et al. ...
-
bioRxiv - Immunology 2021Quote: ... pLenti-GFP (Core with 5’ and 3’ LTR) was also from Addgene (#17448) and the plasmids containing Tat1b and Rev1b (SARS-Related Coronavirus 2 ...
-
bioRxiv - Genetics 2019Quote: ... pDD162 (Peft-3∷Cas9 + Empty sgRNA) 49 was purchased from Addgene (Plasmid #47549). A repair oligo containing mutated PAM and new bases inserted between the sgRNA sequence and PAM (5’-CATGCCAGATCGGAAATCGACATCGAGCCGGACGCGATTCGAAAAGAGGTGCGAAAGCTCCCGGGCTAGCTCGTCGAACGCCAACGCCATCGTCGAATCCACGTACAGCATGCCGGAG-3’ ...
-
bioRxiv - Genetics 2021Quote: ... and 3 μg of each paired TALEN targeting either AAVS1 or CLYBL (Addgene, 59025/59026 or 62196/62197 ...
-
bioRxiv - Cancer Biology 2022Quote: ... PC-3 cells were transduced with lentivirus containing lentiCas9-Blast construct (Addgene #52962) and selected with growth medium containing 4 µg/ml blasticidin for approximately one week ...