Labshake search
Citations for Addgene :
351 - 400 of 2293 citations for 8 chloro 10 3 dimethylamino propyl phenothiazin 1 ol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: Toronto Knockout Version 3 library was purchased from Addgene (#90294) (26) ...
-
MYB68 orchestrates cork differentiation by regulating stem cell proliferation and suberin depositionbioRxiv - Plant Biology 2024Quote: ... and 3) the P336-FBP_11 vector (Available from AddGene (#139702)) ...
-
bioRxiv - Neuroscience 2023Quote: ... a mixture of flexed AAV GFP (pAAV-FLEX-GFP-Virus, titer ≥ 1×10¹³ vg/mL, Addgene 28304-AAV PHPeB) and CamKII-Cre (pENN.AAV.CamKII 0.4.Cre.SV40 ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 μl and 500 nl of AAV9-hSyn-GRAB-rDA1m (2 x 10^13 vg/ml; Addgene, 140556-AAV9) were injected into the dorsal striatum (AP 0.5 mm ...
-
bioRxiv - Neuroscience 2024Quote: ... a total volume of 10-20 ul of AAVrg-FLEX-taCasp3-TEVp (titer >1 × 1012 pfu/ml; Addgene 45580) was injected into the medial and left lobes of the livers of AvilCreERT2 mice ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV injections consisted of a 1:10 cocktail of Cre [AAV5-CMV-HI-eGFP-Cre.WPRE.SV40 (Addgene plasmid no. 105545) packaged at UPenn Vector Core 2.5 × 1014 GC ml−1] and KORD [AAV8-HSyn-DIO-HA-KORD-IRES-mCitrine (Addgene plasmid no ...
-
bioRxiv - Cell Biology 2023Quote: ... 5*10^10 genomic copies of commercially produced AAV8-TBG-Cre (Addgene #107787) or control AAV8-TBG-GFP (Addgene #105535 ...
-
bioRxiv - Neuroscience 2021Quote: ... 2016) (Fig. 5A, Suppl. Figs. 3C,D and 8; Salk Vector Core; 1.0 x 1012; Addgene plasmid #55636); AAV1-SynP-DIO-splitTVA-EGFP-B19G (Fig ...
-
bioRxiv - Cell Biology 2023Quote: ... were transfected with a complex of 4µg of pAAV2/8 (a gift from James M. Wilson, Addgene #112864), 4µg of pHelper (Takara Bio) ...
-
bioRxiv - Microbiology 2021Quote: ... 10 μg of pEA216-1 was then co-transfected with 5 μg of the pCMVΔR8.2 helper plasmid (Addgene Plasmid #122263) and 1 μg of pHEF-VSV-G into 70% confluent monolayers of 293T cells in a 10 cm dish using polyethylenimine (Polysciences Inc ...
-
bioRxiv - Cell Biology 2022Quote: ... organoid fragments were washed and resuspended in Opti-MEM supplemented with Y-27632 (10 µM) and 10µg of pSPgRNA plasmid together with the frame selector plasmid pCAS9-mCherry-Frame +1 (Addgene #66940) and the mNEON targeting plasmid (a kind gift from V ...
-
bioRxiv - Cell Biology 2019Quote: ... Annealed oligos were diluted 1/40 and 1 μl of insert was ligated into 10 ng of digested vector (pU6-sgRNA EF1Alpha-puro-T2A-BFP, Addgene plasmid #60955 digested with BstXI and Blpl ...
-
bioRxiv - Molecular Biology 2024Quote: ... Annealing reactions were diluted 1:10 with water and then 1µL was used to ligate into 100ng of BsmBI digested pLentiGuidePuro vector (Addgene #52963) in 1x T4 DNA Ligase Buffer ...
-
bioRxiv - Molecular Biology 2024Quote: ... Two gRNAs targeting Exon 1 (targeting sequence GGGCGCGCTACCTGTCTCCG) and Exon 10 (targeting sequence GAACTGGACTTTGAAAGAGG) were cloned in BPK1520 (Addgene #65777) and transfected with Amaxa Nucleofector II together with BPK4410 ...
-
bioRxiv - Cancer Biology 2022Quote: ... sgRNA constructs for ANKLE1 knockout were generated by inserting oligonucleotides containing the targeted sequences (5′-TTCAGGGCACAGCCTAGAAC -3′ and 5′-GATTCT-GCCCTAGCCCCACC -3′) into the pX458 vector (Addgene Plasmid #48138 (Ran et al. 2013)) ...
-
bioRxiv - Cell Biology 2020Quote: ... we generated derivatives of pCFD5:U6:3-t::gRNA (Addgene, #73914). A first derivative (pCFD5:U6:3-t::gRNA_pst-1 ...
-
bioRxiv - Genetics 2021Quote: Calu-3 cells were transduced with lenti Cas9-Blast (Addgene #52962), or with lenti dCAS-VP64_Blast (Addgene #61425) ...
-
bioRxiv - Cancer Biology 2021Quote: pcDNA3.1-Myoferlin-HA and peGFP-hGalectin-3 was purchased from Addgene (plasmid no ...
-
bioRxiv - Neuroscience 2023Quote: ... and pC-(lox2-attB2-SA-T2A-Gal4-Hsp70)3 (Addgene #62957) were gifts from Benjamin H ...
-
bioRxiv - Biochemistry 2023Quote: The plasmid used to express Cas1 and Cas2/3 (Addgene #89240) was PCR amplified with mutagenic primer pairs using Q5 polymerase (NEB ...
-
bioRxiv - Plant Biology 2023Quote: ... a C-terminal 3×FLAG® epitope tag (pICSL50007; Addgene #50308), and 3′ UTR and terminator sequences from Agrobacterium tumefaciens nopaline synthase (AtuNOST ...
-
bioRxiv - Genetics 2023Quote: ... pCFD4-U6:1_U6:3 was a gift from Simon Bullock (Addgene plasmid #49411 ...
-
bioRxiv - Microbiology 2023Quote: ... pCfB2904(XI-3 MarkerFree) was a gift from Irina Borodina (Addgene plasmid # 73276 ...
-
bioRxiv - Neuroscience 2023Quote: ... we injected 3×100 nl AAV5.Ef1a.DIO.eYFP (Penn Core, Addgene: 27056) into the mPFC (AP/ML/DV coordinates 2.2 ...
-
bioRxiv - Immunology 2023Quote: ... 10 μg pMD2.G (Addgene) and 100 μL lipofectamine 2000 (Thermo Fisher) ...
-
bioRxiv - Cell Biology 2023Quote: ... AICSDP-10:LMNB1-mEGFP (Addgene plasmid #87422 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 10 μg pMD2.G (Addgene) envelope plasmid and 130 μL 1 μg / mL polyethylenimine (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2023Quote: ... pHAGEmCherry-LC3B (Addgene 201924 10).
-
bioRxiv - Neuroscience 2020Quote: ... Chronos was manufactured at the University of Pennsylvania Vector Core (AAV2/8.Syn.Chronos.tdTomato, Addgene 62726, 1.6×1013 GC/ml). oChIEF was manufactured by Virovek (AAV2/1.CAG.flex.oChIEF.tdTomato ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Optimal magnesium concentration was determined to be 8 mM based on expression of the plasmid pJL1-sfGFP (Addgene #69496) encoding superfolder Green Fluorescent Protein (sfGFP).
-
bioRxiv - Neuroscience 2024Quote: ... 8 rats were bilaterally injected with DREADDs virus AAV5-CaMKIIα-hM4Di-mCherry (titer, 2.3×1013; Addgene http://addgene.org/50477) and 8 rats were bilaterally injected with AAV5-CaMKIIα-mCherry control virus (titer ...
-
bioRxiv - Neuroscience 2024Quote: ... and 8 rats were bilaterally injected with AAV5-CaMKIIα-mCherry control virus (titer, 2.3×1013; Addgene http://addgene.org/114469).
-
bioRxiv - Neuroscience 2023Quote: A Cre-dependent inhibitory optogenetic construct halorhodopsin (eNpHR, AAV5-Ef1a-DIO eNpHR 3.0-EYFP at titer ≥ 1×10¹³ vg/mL, Addgene plasmid # 26966) or an empty vector (control ...
-
bioRxiv - Molecular Biology 2023Quote: ... containing 10% FBS and 1% penicillin-streptomycin, and equal amounts of plasmids (250 ng of each: luciferase reporter, actin-GAL4 (Addgene #24344), one dCas9-Rb constructs ...
-
bioRxiv - Cell Biology 2020Quote: ... an sgRNA (5’-TTGGCACGCCTCCTCAGGCA-3’) was sub-cloned into PX458 (Addgene, 48138). The C-terminal region of the CENP-E gene was amplified with the following primers ...
-
bioRxiv - Developmental Biology 2021Quote: ... or exon 3 of TET3 and cloned into pX330 vector (Addgene #42230) as previously described 47 ...
-
bioRxiv - Developmental Biology 2019Quote: ... 3 µg of the pX-EGFP-g1 expression plasmid (Addgene plasmid #107273)28 was transfected into 1.0 × 106 gene-targeted patient iPSCs ...
-
bioRxiv - Molecular Biology 2019Quote: ... and RPA 2 and 3 were cloned into 11A vectors (Addgene: 48294), followed by assembly of all RPA subunits into one vector by successive ligation independent cloning reactions ...
-
bioRxiv - Neuroscience 2021Quote: pAAV-CaMKIIa-eGFP (titer ≥ 3×1012 vg/mL, Addgene, catalog # 50469-AAV5) and pAAV5-CaMKII-hChR2(H134R)-eYFP-WPRE (titer ≥ 1×1013 vg/mL ...
-
bioRxiv - Neuroscience 2019Quote: ... which were inserted into pDD162 (Peft-3::Cas9 + Empty sgRNA; Addgene #47549), respectively ...
-
bioRxiv - Biochemistry 2021Quote: pCDEF3-hTIM-3 was a gift from Lawrence Kane (Addgene plasmid # 49212), and contained the natural variant L119 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 3 µg pBABE-neo largeT antigen cDNA (Addgene, 1780 ref (16))using lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Developmental Biology 2020Quote: ... The injection mix contained: 60 ng/µl Peft-3::Cas9 (Addgene #46168), 15 ng/µl repair template ...
-
bioRxiv - Biochemistry 2020Quote: pHA#851: osm-10p∷Fynempty∷unc-54 3’UTR (Addgene ID: 139208)
-
bioRxiv - Biochemistry 2020Quote: pHA#853: mec-4p∷Fynempty∷unc-54 3’UTR (Addgene ID: 139210)
-
bioRxiv - Biochemistry 2020Quote: pHA#850: osm-10p∷FynY531F∷unc-54 3’UTR (Addgene ID: 139207)
-
bioRxiv - Cancer Biology 2022Quote: ... 3×106 HEK293T cells were transfected with 2.25 µg psPAX2 (Addgene, 12260), 1.5 µg pMD2.G (Addgene ...
-
bioRxiv - Cancer Biology 2022Quote: ... DCX DNA was cloned into the N-Terminal pFLAG 3 vector (Addgene) by restriction digest using NotI and BamHI restriction enzymes ...
-
bioRxiv - Neuroscience 2022Quote: ... for astrocyte Ca2+ detection or AAV9.hSyn.GCaMP6f (3 × 1012 gc/ml, Addgene) for neuronal Ca2+ detection was mixed with the astrocyte-targeted CalEx encoding construct AAV2/5.GfaABC1D-HA-hPMCA2w/b (1.18 × 1013 gc/ml ...
-
bioRxiv - Cancer Biology 2020Quote: ... or RB1 (5’-GCTCTGGGTCCTCCTCAGGA-3’) were cloned into the lentiCRISPRv2 (Addgene #52961) plasmid ...