Labshake search
Citations for Addgene :
401 - 450 of 3000 citations for 7 Chloro 3 4 2 hydroxyethyl 1 piperazinyl 1 2 propoxyethyl pyrido 3 4 b pyrazin 2 1H one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... we co-transformed plasmids SARS-CoV-2 nsp10 (Addgene ID 169158) and SARS-CoV-2 3xFlag-nsp5CS-nsp14 (Addgene ID 169159) ...
-
bioRxiv - Biophysics 2021Quote: ... the pet28 plasmid containing His6 SARS-CoV-2 nsp13 (Addgene #159390) was transformed into E ...
-
bioRxiv - Neuroscience 2020Quote: Brainbow3.0 AAV-2/9 and AAV-PhP.EB were obtained from Addgene and University of Michigan vector core ...
-
bioRxiv - Systems Biology 2021Quote: ... and pX458-sgRNA_miR290-295_1/2 for KO2 (Addgene #172709 and #172710). After 48 hours ...
-
bioRxiv - Physiology 2021Quote: EGFP-hArgonaute-2 (eGFP-Ago2) was purchased from (Addgene plasmid # 21981) and was prepared in the laboratory of Philip Sharp (MIT) ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV1-flex-ChR2-Tdtomato (Addgene, titer 2*1012/ml, 0.5 μl) or AAV1-flex-ChR2-mCherry (Charite Vector core ...
-
bioRxiv - Cell Biology 2021Quote: The human GeCKO v2 library (2 plasmid system) (Addgene plasmid #1000000049) was amplified by electroporation using a Bio-Rad Gene Pulser II electroporation apparatus (Bio-Rad #165-2105 ...
-
bioRxiv - Cell Biology 2020Quote: Plasmids for biosensors were purchased from Addgene (see Supplementary Table 2). ERKKTR ...
-
bioRxiv - Cell Biology 2021Quote: ... and the three injection markers pCFJ90 (Pmyo-2::mCherry, Addgene #19327), pCFJ104 (Pmyo-3::mCherry ...
-
bioRxiv - Neuroscience 2022Quote: pAAV2/2-hSyn-DIO-hM4D(Gi)-mCherry (Addgene #44362, Roth Lab) was injected intraocularly in VGluT3-Cre mice ...
-
bioRxiv - Molecular Biology 2022Quote: ... psPAX2 packaging vector (2 µg, a gift from Didier Trono; Addgene plasmid #12260 ...
-
bioRxiv - Microbiology 2022Quote: ... 2 µg pSPAX2 (a kind gift from Didier Trono; Addgene #12260), and 2 µg of pcDNA3- SΔ19 with PEI ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 μg pMD2.G envelope plasmid (plasmid #12259; Addgene, Teddington, UK), and 12 μg of the pLJM1 vector for overexpression (plasmid #19319 ...
-
bioRxiv - Bioengineering 2019Quote: ... 2 µL plasmid DNA (ERmoxGFP43, Addgene Cat. # 68072, 420 ng/µL), and 96 µL of PBS ...
-
bioRxiv - Cancer Biology 2019Quote: ... Bcl-2 proteins and their mutants (pMIG-Bcl-xL from Addgene, pMIG-BCL2 [6] ...
-
bioRxiv - Genetics 2020Quote: ... Lentiviral particles were generated in 293T cells using pMDG.2 (Addgene) and psPAX2 (Addgene ...
-
bioRxiv - Developmental Biology 2022Quote: The Capture sequence 2 was added to the gRNA_Purp_Backbone (Addgene #73797) by PCR ...
-
bioRxiv - Neuroscience 2022Quote: [2] piggyBac backbone from pBAC-ECFP-15xQUAS_TATA-SV40 (Addgene, ID #104875) (Riabinina et al. ...
-
bioRxiv - Microbiology 2023Quote: ... and cloned into UC Berkeley Macrolab vector 2-CT (Addgene #29706), which encodes an N-terminal TEV protease cleavable His6-MBP (maltose binding protein ...
-
bioRxiv - Neuroscience 2023Quote: ... virus for optogenetic inhibition or excitation of preBötCOT-R neurons in OT-R::Cre mice was obtained from Addgene (Table 2, Addgene viral prep # 154951; http://n2t.net/addgene:154951; RRID:Addgene_154951)32 ...
-
bioRxiv - Developmental Biology 2023Quote: ... and pBS-KS-attB2-SA(2)-T2A-p65AD-Hsp70 (Addgene #62915). The integration orientation of yellow progenies from MiMIC injection and 3xP3-GFP-progenies from CRIMIC injection were confirmed by PCR genotyping ...
-
bioRxiv - Systems Biology 2023Quote: ... Each promoter was then cloned into the pMW#2 (Addgene #13349) and pMW#3 (Addgene #13350 ...
-
bioRxiv - Microbiology 2023Quote: ... 2 mg VSV-G Env expression vector pMD2.G (Addgene #12259) and 2 mg Gag-Pol expression vector psPAX2 (Addgene #12260 ...
-
bioRxiv - Neuroscience 2023Quote: ... The AAV1-phSyn1(S)-FLEX-tdTomato-T2A-SypEGFP-WPRE virus for tracing experiments from preBötCOT-R neurons to nACardiac neurons in OT-R::Cre mice was obtained from Addgene (Table 2, Addgene viral prep # 51509; http://n2t.net/addgene:51509; RRID:Addgene_51509)55.
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μg of plasmid expressing CRISPR-Cas9 and guide (Addgene #42230) and 40 pmol ssDNA repair template were transfected using Lipofectamine 3000 (Invitrogen L3000001 ...
-
bioRxiv - Microbiology 2024Quote: ... pcDNA3.1-Ha-Dynamin 2.K44A (gift of S. Schmid, Addgene 34685), pEGFPC1 (Clontech) ...
-
bioRxiv - Microbiology 2024Quote: ... pEGFP-Dynamin 2.K44A (gift of P. De Camilli; Addgene 22301), and pEGFP-Dynamin 2ΔPRD (50 ...
-
bioRxiv - Neuroscience 2024Quote: ... driven by synapsin promoter (Addgene, 100843-AAV9, 2×109 vg/coverslip) (20) ...
-
bioRxiv - Cell Biology 2024Quote: The Capture sequence 2 was added to the gRNA_Puro_Backbone (Addgene #73797) by PCR ...
-
bioRxiv - Neuroscience 2020Quote: ... rAAV5-hSyn-DIO-mCherry (Titer ≥ 7×1012 vg.mL−1, Addgene), AAVrg-pCAG-FLEX-tdTomato-WPRE (Titer ≥ 1×1013 vg.mL−1 ...
-
bioRxiv - Neuroscience 2024Quote: ... The he1.1:YFP cassette (he1.1:YFP_F, he1.1:YFP_R, Table 4) was amplified from p3E_he1a:YFP (Addgene, plasmid #113879), and the polyA terminator (polyA_F ...
-
bioRxiv - Neuroscience 2023Quote: Th-cre rats were randomly assigned to a viral group and infused bilaterally with a cre-dependent AAV encoding either ArchT (N = 7; 4 males; AAV5-CAG-FLEX-ArchT-tdTomato, Addgene) or a tdTomato fluorescent protein control (tdTomato ...
-
bioRxiv - Neuroscience 2023Quote: ... or AAV8-hSyn-DIO-GFP (Addgene, n=8, 4 male, 4 female) were injected bilaterally into the BNST (5 × 1012 titer ...
-
Linear ubiquitination at damaged lysosomes induces local NF-κB activation and controls cell survivalbioRxiv - Cell Biology 2023Quote: ... GFP as non-human target (NHT) control (5’-GGAGCGCACCATCTTCTTCA-3’, 5’-GCCACAAGTTCAGCGTGTC-3’, and 5’-GGGCGAGGAGCTGTTCACCG-3’) cloned into pLentiCRISPRv2 (Addgene, 52961, deposited by Feng Zhang). To generate lentiviral particles ...
-
bioRxiv - Neuroscience 2019Quote: A 60 nl viral mix containing a 3:1 ratio of AAV2retro-Cre (AAVrg-pmSyn1-EBFP-cre, Addgene) and AAV2-GFP (UNC viral core ...
-
bioRxiv - Cell Biology 2020Quote: ... was generated by ligating oligonucleotides containing the targeting sequence 5’-CAGTTCCTGGGTGGAGCTA-3’ into pLKO.1-puro (Addgene # 8453). The mitochondrial (CMV-mitoCAR-GECO1 ...
-
bioRxiv - Molecular Biology 2024Quote: ... CASFx-1 (RBFOX1N-dCasRx-C) and CASFx-3 (dCasRx-RBM38) were obtained from Addgene (Plasmid #118635 and #118638). RBFOX1N-dPspCas13b-C was constructed previously 13 ...
-
bioRxiv - Neuroscience 2023Quote: ... Suppl Fig 3: AAV9-CaMKIIa-hChR2-EYFP (1:5, Addgene viral prep #26969- AAV9; http://n2t.net.addgene:26969; RRID; Addgene:26969 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and g2 (5’- CCATGTATGGGGTCACAGCCTCTGCTAGGACCAAGCCAAGACCATCTGCTGTCACAACCACTGC ACACCTGG-3’) and cloned these guides into the All-in-one (AIO)-PURO vector encoding the Cas9D10A nickase (Addgene #74630). U2OS cells were treated with 2 µg/mL of puromycin (Invitrogen ...
-
bioRxiv - Developmental Biology 2023Quote: ... lentiviral supernatants were generated by transfecting one 10-cm plate of HEK-293T cells at 90% confluency with 3 µg pMD2.G (Addgene #12259), 9 µg psPAX2 (Addgene #12260) ...
-
bioRxiv - Bioengineering 2022Quote: ... we generated one plasmid harboring 4 distinct sgRNAs targeting the promoter region of AaRel1 (AAEL007696, OA-1127B, Addgene plasmid #190997). Firstly ...
-
bioRxiv - Neuroscience 2022Quote: ... A pcDNA3 flag HA 14-3-3 β plasmid was a gift from William Sellers (Addgene plasmid # 8999 ...
-
bioRxiv - Cell Biology 2023Quote: ... and let-858 3’ UTR and mKate::HA::let-858 3’UTR from pDD287 (Addgene #70685). Correct sequences of constructed plasmids were confirmed with Sanger sequencing ...
-
bioRxiv - Neuroscience 2023Quote: 1-4 evenly spaced ∼60 nl injections of the AAV1-synapsin-l-GCamp6f (Addgene, MA stock #100837) that had been diluted to a titer of ∼1×10^12 vg/mL using sterile PBS were made in each cranial window ...
-
bioRxiv - Neuroscience 2023Quote: ... we generated small guide RNAs to PAM sites in proximity to exons 4 and 7 of the murine Grik3 locus and cloned these into the pSpCas9(BB)-2A-GFP (PX458) backbone (Addgene #48138), where expression of the sgRNAs is controlled under the U6 promoter ...
-
bioRxiv - Cell Biology 2020Quote: ... MKL1/2 shRNA construct was obtained from Addgene (Lee et al., 2010). CAG:GFP construct was obtained from Cellomics Technology (PLV10057) ...
-
bioRxiv - Cell Biology 2020Quote: ... Beta-2-adrenergic receptor-CFP was a gift from Catherine Berlot (Addgene plasmid # 55794 ...
-
bioRxiv - Immunology 2021Quote: Recombinant SARS-CoV-2 HexaPro spike and RBD were produced from Addgene plasmid #154754 (50 ...
-
bioRxiv - Neuroscience 2020Quote: The pCMV4-FLAG-UBQLN2 plasmid (p4455 FLAG-hPLIC-2; Addgene plasmid # 8661) and pCS2-FLAG-UBQLN1 plasmid (p4458 FLAG-hPLIC-1 ...
-
bioRxiv - Molecular Biology 2020Quote: ... supplemented with 2 ng/μl RNase-free plasmid DNA (pX330, Addgene #42230) in a 15 ml Falcon tube ...