Labshake search
Citations for Addgene :
251 - 300 of 3000 citations for 7 Chloro 3 4 2 hydroxyethyl 1 piperazinyl 1 2 propoxyethyl pyrido 3 4 b pyrazin 2 1H one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... HEK 293T cells were transfected with either sulfatase 1 or sulfatase 2 expression plasmids or empty vector control derived from pcDNA3.1 (RRID: Addgene_79663) using Lipofectamine 3000 (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2023Quote: ... We generated monoclonal U2OS cell lines expressing the following fluorescent plasmids: 1) ptfLC3B was a gift from Tamotsu Yoshimori (Addgene plasmid #21074; http://n2t.net/addgene:21074; RRID:Addgene_2107443; 2) pMXs-puro GFP-DFCP1 was a gift from Noboru Mizushima (Addgene plasmid #38269 ...
-
bioRxiv - Biochemistry 2024Quote: ... Cells were subcultured twice a week at a ratio of 1:5 to 1:8.Transient transfection of HeLa cells (1–2 x 105 cells/6-well) with pcDNA3.1(+) NAPstar or pSC2 HyPer7 (Addgene; plasmid #136466 ...
-
bioRxiv - Immunology 2024Quote: ... the single guide RNA (sgRNA) sequences targeting exon 1 or 2 of murine IFNγR1 were cloned into the pX458 backbone (Addgene) containing Cas9 expression and GFP expression ...
-
bioRxiv - Immunology 2021Quote: pcDNA3.1-SARS-CoV-2 Spike (Addgene plasmid #145302) was used to clone SARS-CoV-2 S gene into the SFG backbone using the In-Fusion Cloning kit (Takara Bio) ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 µg of psPAX2 (Addgene, #12260, MA, USA) and 2 µg of lentiCRISPRv2 sgRNA DMT1 ...
-
bioRxiv - Genetics 2020Quote: ... and pCFJ90 Pmyo-2-mCherry (Addgene plasmid 19327) and pCFJ104 Pmyo-3-mCherry (Addgene plasmid 19328)(Frøkjær-Jensen et al. ...
-
bioRxiv - Biochemistry 2020Quote: ... and combined with pX330A-2-PITCh (Addgene #63670) by golden gate cloning ...
-
bioRxiv - Molecular Biology 2023Quote: ... PITCh sgRNA from pX330S-2-PITCh (Addgene #63670) was cut-out via Eco31I (Thermo Fisher Scientific ...
-
bioRxiv - Pathology 2023Quote: ... 2 µg of pCA-mTmG plasmid (#26123, Addgene) was added to diluted TAT-Cre and incubated at 37°C for 1 hour ...
-
bioRxiv - Microbiology 2023Quote: ... and pDONR223 SARS-CoV-2 spike (Addgene #149329) were subcloned into pLVpuro-CMV-N-3xFLAG (Addgene #123223 ...
-
bioRxiv - Microbiology 2023Quote: ... and pMD.2 (Didier Trono, Addgene plasmid # 12259), combined with either Cas9 expression vector plenti-Cas9-blast (Feng Zhang ...
-
bioRxiv - Biophysics 2023Quote: The plasmid pr8ΔEnv.2 was obtained from Addgene, Plasmid #12263) ...
-
bioRxiv - Plant Biology 2023Quote: ... the AtCas9 (2×35S::AtCAS9-OCST; Addgene #112079) and the linker pICH41780 (Addgene #48019 ...
-
bioRxiv - Neuroscience 2024Quote: ... 85 nl of AAV1-hSyn:Cre (Addgene, 2 × 1013) was injected into vCA1 and 200 nl of a 1:1 cocktail of AAV9-pMeCP2:DIO-Cas9 (2 × 1012 GC/ml ...
-
bioRxiv - Neuroscience 2024Quote: ... and pAAV2/2 (for AAV2; Addgene plasmid # 104963), pAAV2/5 (for AAV5 ...
-
bioRxiv - Bioengineering 2024Quote: ... and exon 2-8 was cloned from Addgene #182141 ...
-
bioRxiv - Cancer Biology 2024Quote: ... PITCh sgRNA from pX330S-2-PITCh (Addgene #63670) vector was then inserted into the pX330A-1x2-cNAT10 vector using Golden Gate Assembly (New England Biolab ...
-
bioRxiv - Cell Biology 2021Quote: ... pcDNA3-HA-14-3-3 beta (14-3-3β) was a gift from Michael Yaffe (Addgene #13270). pclbw-opa1(isoform 1)-myc (myc-Opa1 ...
-
bioRxiv - Microbiology 2023Quote: ... ATG16L1 shRNA (5’-GTCATCGACCTCCGGACAAAT-3’) was inserted into pLKO.1 puro (Addgene plasmid #8453) to generate pLKO.1-ATG16L1-shRNA ...
-
bioRxiv - Cancer Biology 2023Quote: ... sh2: 5-CCAACAACATCTTCTGCTCC-3’ were cloned into the lentiviral vector pLKO.1 (Addgene #8453)[16] ...
-
bioRxiv - Genomics 2022Quote: ... gRNAs were constructed from pSLQ2853-3 pHR: U6-Sasgv2CXCR4-1 CMV-EGFP (Addgene 84254) and pSLQ1852-2 pHR ...
-
bioRxiv - Neuroscience 2023Quote: ... 0.75 µL of rgAAV-FLEX-tdTomato (diluted 1:3 in dPBS; Addgene number: 28306) was injected in TH-Cre mice in basal forebrain (AP ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2μg of target shRNA construct and 2μg of 3:1 ratio of psPAX2 (Addgene) and pMD2.G (Addgene ...
-
bioRxiv - Microbiology 2021Quote: ... 2 x 105 cells were seeded on 12-well plates and transiently transfected with 2 μg of plasmids encoding SARS-CoV-2 N (Addgene # 141391) or eGFP (Addgene # 141395 ...
-
bioRxiv - Microbiology 2023Quote: ... pLVX-EF1a-SARS-CoV-2-nsp16-IRES-puro was generated by subcloning the nsp16 coding sequence from pDONR223 SARS-CoV-2 NSP16 (Addgene #141269) into pLVX-EF1a-IRES-puro empty vector ...
-
bioRxiv - Microbiology 2023Quote: ... cells were transfected with 250 ng of plasmids encoding the SARS-CoV-2 S genes delivered by pTwist-SARS-CoV-2 Δ18 D614G (Addgene, 164437) or pTwist-SARS-CoV-2 Δ18 B.1.1.529 (Addgene ...
-
bioRxiv - Microbiology 2024Quote: ... Plasmids expressing GST-tagged WT Dynamin 2 or Dynamin 2 ΔPRD were constructed using the Takara Biosciences In-Fusion system and a plasmid encoding rat WT Dynamin 2 (Addgene 34684) as a template ...
-
bioRxiv - Neuroscience 2023Quote: ... Male (N = 2) and female (N = 2) naïve mice were infused bilaterally with the anterograde tracer AAV8-Syn-mCherry (Addgene, Watertown, MA) in the CeA (0.2 µL) ...
-
bioRxiv - Cancer Biology 2023Quote: ... from the expression vector pcDNA3.1/Myc-His(-)-HSulf-2 bearing human Sulf-2 cDNA (a gift from Steven Rosen, Addgene plasmid # 13004) (Morimoto-Tomita et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... mCherry-Mito-7 and mCherry-ER-3 were kindly provided by Michael Davidson (Addgene plasmids #55102 and #55041).
-
bioRxiv - Cell Biology 2020Quote: ... Nsp1-NT (1-127 aa) and Nsp1-CT (128-180 aa) were amplified from pDONR207 SARS-CoV-2 NSP1 (Addgene) by PCR and then cloned into pDB-His-MBP or BacMam pCMV-Dest plasmid ...
-
bioRxiv - Bioengineering 2022Quote: ... sgRNA cassette) were PCR-amplified and recloned into 2 lentiviral plasmids (pLKO.1 neo, Addgene #13425; pLJM-EGFP, Addgene #19319) and ...
-
bioRxiv - Neuroscience 2020Quote: ... injections of rAAV2-retro-Cre (produced by Salk Vector Core or Vigene, 2×1012 to 1×1013 viral genomes/ml, produced with capsid from Addgene plasmid #81070 packaging pAAV-EF1a-Cre from Addgene plasmid #55636 ...
-
bioRxiv - Microbiology 2021Quote: Individual sgRNAs (sgLRRC15 #1: GACATGCAGGCACTGCACTG; sgLRRC15 #2: AGTGTCAGCCCGGGACATGC; sgACE2: GTTACATATCTGTCCTCTCC) targeting the candidate genes were cloned into linearized pXPR_502 (Addgene, #96923) for CRISPR activation ...
-
bioRxiv - Cell Biology 2022Quote: ... talin 2 shRNA-stable cells were co-transfected with Tln1 siRNA and EGFP-talin 1 head (Addgene plasmid no. 32856) or EGFP-talin 1 L325R (the mutant version ...
-
bioRxiv - Immunology 2020Quote: ... with lentiviral packaging vectors pCAG-eco and psPAX.2 plus empty pLKO.1 control (EV) with a puromycin selection cassette (all obtained from Addgene) or a shRNA containing pLKO.1 targeting DGAT1 (GE Dharmacon CAT# RMM4534-EG13350 - TRCN0000124791) ...
-
bioRxiv - Neuroscience 2020Quote: ... The loxP-NeoR-loxP cassette was inserted at the MluI site in the intron between exons 1 and 2 following PCR amplification from pL452 (Addgene) using primers 3-For and 3-Rev ...
-
bioRxiv - Immunology 2022Quote: ... with lentiviral packaging vectors pCAG-eco and psPAX.2 plus empty pLKO.1 control (EV) with a puromycin selection cassette (all obtained from Addgene) or a shRNA containing pLKO.1 targeting Cpt1a (GE Dharmacon CAT# RMM3981-201819967 – TRCN0000110596 ...
-
bioRxiv - Cell Biology 2022Quote: ... was constructed by recombining pENTR1a emGFP-Slc37a2 iso 2 with the pLenti PGK Hygro DEST (w530-1) vector (a gift from Eric Campeau and Paul Kaufman, Addgene plasmid # 19066 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Nsp1-NT (1-127 aa) and Nsp1-CT (128-180 aa) were amplified from pDONR207 SARS-CoV-2 NSP1 (Addgene) by PCR and then cloned into pDB-His-MBP or BacMam pCMV-Dest plasmid ...
-
bioRxiv - Neuroscience 2023Quote: ... injections of rAAV2-retro-Cre (produced by Salk Vector Core or Vigene, 2×1012 to 1×1013 viral genomes/ml, produced with capsid from Addgene plasmid #81070 packaging pAAV-EF1a-Cre from Addgene plasmid #55636 ...
-
bioRxiv - Cell Biology 2024Quote: ... we received plasmids encoding WT SARS-CoV-2 SP (Wuhan-Hu-1) and its receptor binding domain (RBD) from Addgene under a Material Transfer Agreement ...
-
bioRxiv - Cancer Biology 2024Quote: ... sgRNA oligonucleotides purchased from IDT were annealed and ligated in the BbsI restriction site of pX330A-1×2 (Addgene, #58766) plasmid to make pX330A-1x2-cNAT10 vector ...
-
bioRxiv - Microbiology 2022Quote: ... All shRNAs were generated by cloning shRNA hairpin sequences found in Table 3 into pLKO.1-TRC Puro (pLKO.1-TRC cloning vector was a gift from David Root (Addgene plasmid # 10878 ...
-
bioRxiv - Molecular Biology 2021Quote: ... of 14-3-3 theta into pEBFP2-C1 (Addgene plasmid #54665). A CHIP plasmid78 was a gift from Leonard Petrucelli and the CHIP ORF was cloned into pCMV-C2-6myc ...
-
bioRxiv - Cell Biology 2022Quote: ... GFP-Galectin-3 was subcloned from ptf-Galectin-3 (Addgene: 64149). pMXs-puro eGFP-p62 was a gift from Noboru Mizushima (Addgene plasmid # 38277 ...
-
bioRxiv - Neuroscience 2020Quote: One adult mouse (~ 2 months) was stereotaxically injected with a GCaMP6f construct (AAV5.CamKII.GCaMP6f.WPRE.SV40 virus, Addgene # 100834; 0.4 μL at 0.06 μl/min) in hippocampal CA1 ...
-
bioRxiv - Cell Biology 2021Quote: Stock of lentiviral particles were obtained by transfection of HEK293T cells (2×106 cells) with 2 μg of lentivector plasmid lentiCRISPRv2 (a gift from Feng Zhang, Addgene plasmid, 52961) expressing single guide RNA targeting an exon within ATG5 gene ...
-
bioRxiv - Immunology 2020Quote: ... pTwist EF1 Alpha-SARS-Cov-2-S-2xStrep plasmid encoding for the SARS-CoV-2 Spike protein was a gift from Nevan Krogan (Addgene plasmid #141382). pcDNA3-sACE2(WT)-Fc(IgG1 ...