Labshake search
Citations for Addgene :
351 - 400 of 10000+ citations for Rat SEPT12 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2023Quote: ... HEK293T cells were transfected with transfer plasmid and two helper plasmids psPAX2 (Addgene plasmid #12260) and VSV-G envelope expressing plasmid (pMD2.G ...
-
bioRxiv - Bioengineering 2021Quote: ... 5 uL of serum-free media was added to 200 ng of plasmid DNA (100 ng CAG-nanobody-TagBFP plasmid and 100 ng CAG-dsRed plasmid (Addgene plasmid 11151) (Matsuda and Cepko ...
-
bioRxiv - Cell Biology 2022Quote: ... HEK293 cells were transfected with 4µg shRNA p53-puromycin (Fachinetti Lab) + 4µg pMD2.G (12259 from Addgene, RRID:Addgene_12259) + 4µg psPAX2 (12260 from Addgene ...
-
bioRxiv - Cancer Biology 2019Quote: ... Knockdown experiments with shRNA lentiviruses were conducted according to the standard lentivirus package and transduction protocols from Addgene. These pLKO-based lentiviral shRNA plasmids were co-transfected with packaging plasmids (psPAX2 and pMD2.G ...
-
bioRxiv - Cell Biology 2022Quote: ... shRNA sequences containing the following target sequences were cloned into the pLKO.1-TRC cloning vector (Addgene, 10878): nontargeting (NT) ...
-
bioRxiv - Microbiology 2022Quote: ... shRNA sequence of p21 (shp21.1:TRCN0000287021, shp21.2:TRCN0000040126) were cloned into lentiviral vector pLKO.1 neo (Addgene#13425) or pLKO.1 mCherry-Puro generated by overlapping PCR using primer pairs (Table S1 ...
-
bioRxiv - Immunology 2022Quote: shRNAs were designed to target human Galectin-9 mRNA and cloned into the pLKO.1 vector (Addgene #10878). The sense shRNA sequences are CCTGGTGCAGAGCTCAGATTT (shGal-9 #1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Lentiviral doxycycline-inducible shRNAs (targeting DDX46 and HTATSF1) were prepared in the Tet-pLKO-puro backbone (Addgene # 21915) by cloning the gene-targeting annealed oligos also identified from the above url into the AgeI - EcoR1 sites (details in TableS5) ...
-
bioRxiv - Cell Biology 2024Quote: ... shRNAs with sequences listed in Table S3 were cloned into tet-inducible vector Tet-pLKO-puro (Addgene #21915). To generate luciferase reporters ...
-
bioRxiv - Cancer Biology 2019Quote: ... utilising the following expression plasmids: pMSCV16E6 (Addgene plasmid # 42603), pMSCV16E7 (Addgene plasmid # 35018 ...
-
bioRxiv - Genomics 2019Quote: ... a plasmid encoding His6MBP-SpCas9-2xNLS (Addgene plasmid #69090) was transformed into Rosetta2(DE3 ...
-
bioRxiv - Genomics 2019Quote: ... together with the packaging plasmids psPAX2 (Addgene Plasmid #12260), and VSV.G (Addgene Plasmid #14888 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The pCas plasmid was purchased from (Addgene plasmid #60847) and modified to express the hphNT1 cassette to confer hygromycin resistance ...
-
bioRxiv - Cell Biology 2021Quote: ... and pMD2.G plasmid (Addgene. Watertown, MA, plasmid 12259) deposited by Dr ...
-
bioRxiv - Cancer Biology 2020Quote: ... The LTR-driven plasmids expressing LT (Addgene plasmid # 14088), H-Ras V12 (Addgene plasmid # 18749) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Not1-linearized pBabe-puro largeTcDNA plasmid (Addgene plasmid # 14088) was transfected into mouse and naked mole-rat skin fibroblasts and selected with puromycin for 2-4 weeks (mouse cells took ~2 weeks ...
-
bioRxiv - Cell Biology 2021Quote: ... The pLJC5-LAMP1-RFP-2xFLAG plasmid (Addgene plasmid #102931) (Abu-Remaileh et al ...
-
bioRxiv - Neuroscience 2020Quote: ... and the packaging plasmids: pRSV-Rev (Addgene plasmid #12253) and pMDLg/pRRE (Addgene #12251) ...
-
bioRxiv - Cell Biology 2021Quote: ... using NheI/BamHI linearized plasmid backbones (Addgene plasmid #54759) and the oligonucleotide primer sequences (listed in Supplementary Table 1) ...
-
bioRxiv - Biophysics 2020Quote: ... 6750 ng of psPAX2 packaging plasmid (Addgene plasmid # 12260), and 750 ng of Spike-18aa truncated (Addgene plasmid # 149541 ...
-
bioRxiv - Neuroscience 2022Quote: ... along with the packaging plasmid psPAX2 (Addgene Plasmid #12260) and the VSV-G envelope plasmid PMD2.G (Addgene Plasmid #12259) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 6750 ng of psPAX2 packaging plasmid (Addgene plasmid # 12260), and either 750 ng of Spike-18aa truncated (Addgene plasmid # 149541) ...
-
bioRxiv - Molecular Biology 2020Quote: ... brucei SM with plasmid p221-purVSG117UTR (Addgene plasmid 59732) or with p221-purVSG117UTRmut (Addgene plasmid 59732,7) ...
-
bioRxiv - Biochemistry 2021Quote: A PCR product from plasmid pDD282 (Addgene plasmid # 66823) was used as a donor template for insertion of gfp ...
-
bioRxiv - Genetics 2022Quote: ... The XbaI-digested pT3TS-nCas9n plasmid (Addgene plasmid #46757) was used as a template to transcribe Cas9 mRNA with the T3 mMESSAGE kit (Invitrogen) ...
-
bioRxiv - Genetics 2022Quote: ... and pLOX-Ttag-iresTK plasmids (Addgene ID Plasmid #12246) were transfected into HEK293T cells with lipofectamine 2000 (Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2019Quote: ... coli cells using the plasmid pRK793 (Addgene, Plasmid # 8827)55 ...
-
bioRxiv - Cancer Biology 2021Quote: PCS2 CreNLS plasmid 64 and PX330 plasmid (Addgene # 42230) were used in this study ...
-
bioRxiv - Cell Biology 2020Quote: pcDNA-GFP plasmid was purchased from Addgene (Plasmid #13031). CAD or SH-SY5Y cells were seeded into 24-well tissue culture plates containing glass coverslips at 1×105 cells per well 17-24 hs before transfection ...
-
Microbial signals and lymphotoxin drive TNF-independent death of A20 and ABIN-1 deficient epitheliumbioRxiv - Immunology 2021Quote: ... and the envelope plasmid pMD2.G (Addgene Plasmid #12259) into HEK293T (ATCC ...
-
bioRxiv - Bioengineering 2022Quote: ... we modified plasmid OA-984 [77] (Addgene plasmid #120363) to contain 2 sgRNA sequences targeting either eve or hh driven by U6 promoters (sgRNAeve and sgRNAhh) ...
-
bioRxiv - Neuroscience 2022Quote: ... and the rescue plasmids pCAG-VSVP (Addgene, Plasmid #64088), pCAG-VSVN (Addgene ...
-
bioRxiv - Cell Biology 2022Quote: ... and 5 µg packaging plasmid pUMVC (Addgene, Plasmid #8449). Virus particles were collected 48 h after transfection ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... a minor variant of plasmid pSKunk3 (AddGene plasmid #61531) (Firnberg and Ostermeier 2012) ...
-
bioRxiv - Molecular Biology 2023Quote: The reporter plasmid (CDKN1A/WAF1 promoter, Addgene plasmid #16451) was kindly provided by Dr ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 3 μg of plasmid VSVG (Plasmid #8454, Addgene). Cells were incubated at 37°C ...
-
bioRxiv - Cell Biology 2023Quote: ... mVenus-Integrin-Beta1-N-18 plasmid (Addgene plasmid #56330) was obtained from Addgene (USA) ...
-
bioRxiv - Bioengineering 2022Quote: ... and a GFP plasmid (pcDNA3-EGFP, Addgene plasmid #13031) were purchased from Addgene ...
-
bioRxiv - Cell Biology 2023Quote: ... The plasmids pCS2TAL3-RR-zrif1-exon8 (Addgene plasmid 194434), pCS2TAL3-DD-zrif1-exon8 (Addgene plasmid 194435) ...
-
bioRxiv - Genomics 2023Quote: ... pJFRC12-10XUAS-IVS-myr::GFP plasmid (Addgene, Plasmid #26222) (Pfeiffer et al. ...
-
bioRxiv - Immunology 2023Quote: ... and 7.5ug of envelope plasmid psPAX2 (Plasmid #12260, Addgene) were diluted in 250uL Opti-MEM (Gibco) ...
-
bioRxiv - Immunology 2023Quote: ... 2.5ug of packaging plasmid pMD2.G (Plasmid #12259, Addgene), and 7.5ug of envelope plasmid psPAX2 (Plasmid #12260 ...
-
bioRxiv - Microbiology 2023Quote: ... The HindIII- linearized p1NIL plasmid (Addgene plasmid number 20187) was ligated with the HindIII- digested PCR product ...
-
bioRxiv - Immunology 2023Quote: ... the second-generation lentiviral packaging plasmid (Addgene plasmid #12260), and a VSV G-expressing vector (Addgene plasmid #12259 ...
-
bioRxiv - Biochemistry 2023Quote: ... and inserted into PEmax mRNA plasmid (Addgene plasmid #204472) digested by SalI and EcoRI ...
-
bioRxiv - Biochemistry 2023Quote: The β-lactamase plasmid (pExp-Bla, Addgene plasmid #112561) was expressed in E ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 3 μg of plasmid VSVG (Plasmid #8454, Addgene) in a 10 cm dish ...
-
bioRxiv - Cell Biology 2023Quote: ... the Renilla luciferase plasmid (pRL-SV40, Addgene plasmid #27163) was a gift from Ron Prywes and ISRE luciferase plasmid was gifted by Dr ...
-
bioRxiv - Developmental Biology 2023Quote: ... Firefly reporter plasmids: SuperTopflash (STF; 0.2ug, Addgene plasmid #12456) and Activating Transcription Factor 2 (0.4ug ...
-
bioRxiv - Molecular Biology 2024Quote: ... integrated using Piggybac plasmid EFa1-Transposase (Addgene plasmid 172116) via lipofectamine (ThermoFisher STEM00015 ...