Labshake search
Citations for Addgene :
151 - 200 of 10000+ citations for Rat SEPT12 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: DIV06 rat cortical neurons were infected with AAV5 virus based on the AAV-Flex-TACasp3-TEVP plasmid (Addgene #45580)83 at a titer of >7x108 vg/ml ...
-
bioRxiv - Developmental Biology 2020Quote: ... A control PLKO.1 vector containing a scrambled shRNA (Addgene 1864) was used as a control ...
-
bioRxiv - Cell Biology 2019Quote: ... Selected shRNAs were cloned into a modified lentiviral vector (Addgene #12247) using MluI and ClaI restriction sites ...
-
bioRxiv - Neuroscience 2021Quote: ... DNA templates and shRNA oligoes mentioned above were acquired from Addgene or synthesized from BGI (Shenzhen ...
-
bioRxiv - Cancer Biology 2020Quote: shRNAs were subcloned into a Tet-on pLKO-puro (Addgene, #21915) via AgeI and EcoRI restriction sites ...
-
bioRxiv - Cell Biology 2020Quote: ... pBrain-GFP-shTACC3 shRNA was a gift from Stephen Royle (Addgene plasmid # 59355 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The shRNAs used were either purchased from Addgene (shCtrl: Addgene #1864) or designed using the Genetic Perturbation Platform.
-
bioRxiv - Immunology 2023Quote: ... The shRNAs were cloned separately into LentiCRISPRv2-GFP (modified from Addgene) and transiently co-transfected with psPAX2 (12260 ...
-
bioRxiv - Cancer Biology 2023Quote: ... shRNA sequences were cloned into pSIH1-H1-puro vector (#26597; Addgene). cDNA sequences of PAK1 mutants with a C-terminus Flag tag were synthesized at BGI Genomics (Beijing ...
-
bioRxiv - Neuroscience 2024Quote: ... a subgroup of animals within each rat subline received AAV5-hSyn-DOI-mCherry (7.10¹² vg/mL, Addgene, plasmid number 50459). After injections ...
-
bioRxiv - Cell Biology 2020Quote: ... MKL1/2 shRNA construct was obtained from Addgene (Lee et al., 2010). CAG:GFP construct was obtained from Cellomics Technology (PLV10057) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Nontargeting shRNA in pLKO.1 (shSCR) was used as a control (Addgene). For sgRNA experiments ...
-
bioRxiv - Cancer Biology 2020Quote: ... Control Scramble shRNA sequence (CCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGG) was the same as that from Addgene Plasmid # 1864.
-
bioRxiv - Neuroscience 2021Quote: ... the AAV-shRNA-ctrl was a gift from Hongjun Song (RRID: Addgene_85741) (Yu et al. ...
-
bioRxiv - Systems Biology 2023Quote: ... Control shRNAs targeting luciferase or GFP were previously described (Addgene #83092, #83085) 33.
-
bioRxiv - Cancer Biology 2024Quote: ... The backbone vector for shRNAs was purchased from Addgene (pLKO.1_mCherry, 128073). We followed the shRNA construction protocol from the Genetic Perturbation Platform web portal (https://portals.broadinstitute.org/gpp/public/resources/protocols) ...
-
bioRxiv - Neuroscience 2023Quote: ... RSPO2 shRNAs were cloned into the pLentiLox 3.7 lentiviral vector (PLL3.7, AddGene), which co-expresses green fluorescent protein (GFP) ...
-
bioRxiv - Microbiology 2024Quote: ... Plasmids expressing GST-tagged WT Dynamin 2 or Dynamin 2 ΔPRD were constructed using the Takara Biosciences In-Fusion system and a plasmid encoding rat WT Dynamin 2 (Addgene 34684) as a template ...
-
bioRxiv - Molecular Biology 2021Quote: ... The nontargeting shRNA pLKO.1-blast-SCRAMBLE was obtained from Addgene (Catalog #26701). Two shRNAs for each target were obtained and stable lentiviral transductions with the targeted shRNAs and the scramble control were performed ...
-
bioRxiv - Cell Biology 2022Quote: ... shRNA construct along with two helper DNA constructs (pHR-CMV8.2 deltaR (Addgene 8454) and pCMV-VSVG (Addgene 8455) ...
-
bioRxiv - Cancer Biology 2020Quote: ... shRNAs were cloned into Tet-pLKO-Puro (a gift from Dmitri Wiederschain (Addgene plasmid # 21915 ...
-
bioRxiv - Cancer Biology 2021Quote: ... A non-targeting control shRNA vector (sh:SCR) was purchased from Addgene (Watertown, MA). Plasmids were packaged with the third-generation lentiviral packaging system (VSV-G ...
-
bioRxiv - Cell Biology 2021Quote: ... Cloning of shRNAs was conducted according to the pLKO.1 protocol (Addgene 2006). YAP 6SA was subcloned into pLJM1 by PCR amplification using primers (For ...
-
bioRxiv - Cancer Biology 2023Quote: pLKO-Tet-puro-hRAF1-shRNA-1 was a gift from Ayaz Najafov (Addgene plasmid # 185371 ...
-
bioRxiv - Cancer Biology 2023Quote: Lentiviral gene-specific shRNAs were prepared in pLKO.1-puro backbone (Addgene # 8453) (identified from verified sequences at https://www.sigmaaldrich.com/US/en/product/sigma/shrna ...
-
bioRxiv - Cancer Biology 2023Quote: ... Specific shRNA oligonucleotides targeting USP39 were cloned into the pLL3.7 lentiviral vector (Addgene). These plasmids ...
-
bioRxiv - Cell Biology 2023Quote: ... YAP-targeting shRNA vectors 1 and 2 refer to pLKO1-shYAP1 (Addgene, #27368) and pLKO1-shYAP2 (Addgene ...
-
bioRxiv - Cell Biology 2024Quote: ... and Deaf1 shRNAs were cloned into pAAV-Ptet-RFP-shR-rtTA (Addgene, #35625). The Deaf1 and Deaf1-shRNA carrier AAV vectors were transfected with pAAV-R/C (AAV serotype 9 [AAV9] ...
-
bioRxiv - Physiology 2023Quote: ... Rat cacna2d1 (RRID: Addgene_26575) and cacna1a were gifts from D ...
-
bioRxiv - Cancer Biology 2022Quote: ... The shRNA sequences were cloned into the pSIH1-puro vector (#26597; Addgene, MA, USA). Lentiviruses were produced in 293T cells with a second-generation packaging system containing psPAX2 (#12260 ...
-
bioRxiv - Systems Biology 2020Quote: ... We packaged shRNA lentivirus using pMD2.G (Addgene 12259; a gift from Didier Trono) and psPAX2 (Addgene 12260 ...
-
Optimized RNA-targeting CRISPR/Cas13d technology outperforms shRNA in identifying essential circRNAsbioRxiv - Molecular Biology 2020Quote: ... The oligonucleotides for shRNA were cloned into the pLKO.1-TRC vector (Addgene #10878) using AgeI/EcoRI ...
-
bioRxiv - Genetics 2022Quote: ... UAS-shRNAs were generated according to the TRiP protocol using the pVALIUM20 vector (Addgene) (64) ...
-
bioRxiv - Molecular Biology 2023Quote: ... we cloned the shRNA targeting TET2 into the pLKO.1-blast vector (Addgene #26655). Plasmids were generated using PCR ...
-
bioRxiv - Cancer Biology 2024Quote: ... the shRNA constructs were packaged into second-generation virus particles using psPAX2 (Addgene #12260) and pMD2.G (Addgene #12259 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2μg of target shRNA construct and 2μg of 3:1 ratio of psPAX2 (Addgene) and pMD2.G (Addgene ...
-
bioRxiv - Cell Biology 2019Quote: ... gRNA plasmid (Addgene plasmid #103854) and non-targeting gRNA plasmid (Addgene plasmid #103868 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Plasmids pIB166 (Addgene plasmid # 90189), pIB184-Km (Addgene plasmid # 90195 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Plasmids psPAX2 (Addgene plasmid, 12260) and pMD2.G (Addgene plasmid ...
-
bioRxiv - Cell Biology 2024Quote: ... PAX2 plasmid (Addgene, Plasmid # 35002) and pMD2.G plasmid (Addgene ...
-
bioRxiv - Molecular Biology 2020Quote: shRNAs targeting PUS7 and RPUSD4 were cloned into the lentiviral vector pLKO-Tet-On (Addgene) digested with AgeI-HF and EcoRI-HF to remove the stuffer sequence ...
-
bioRxiv - Cancer Biology 2020Quote: Two distinct shRNA for each target gene were cloned into pLKO.1 puro (Addgene #8453) according to the corresponding protocol ...
-
bioRxiv - Neuroscience 2020Quote: ... Scramble shRNA was used for control electroporations and was a gift from David Sabatini (Addgene plasmid # 1864 ...
-
bioRxiv - Cancer Biology 2019Quote: Two independent shRNA vectors targeting RB1 were obtained from Addgene (Addgene ID: 25640 and 25641). Lentivirus was produced using standard virus production methods by co-transfecting target and packaging plasmids into HEK293T cells ...
-
bioRxiv - Cancer Biology 2023Quote: AW13516 cell lines stably expressing either non-targeting scrambled shRNA (#1864) (Addgene, Cambridge, Massachusetts, USA) or shRNAs targeting C1QBP or TRIM23 were employed to study the effect of knockdown on the tumorigenic potential of cancer cells ...
-
bioRxiv - Biochemistry 2024Quote: ... shRNA sequences targeting murine ACLY or non-targeting controls were cloned into LT3-GEPIR (Addgene), the shRNA sequences used were (TGCTGTTGACAGTGAGCGACCGCAGCAAAGATGTTCAGTATAGTGAAGCCACAGA TGTATACTGAACATCTTTGCTGCGGCTGCCTACTGCCTCGGA) ...
-
bioRxiv - Genomics 2020Quote: ... transfected with lentiviral transfer plasmids and packaging plasmids helper plasmids pCMV-VSV-G (Addgene plasmid #8454) and pCMVR8.74 (Addgene plasmid #22036 ...
-
bioRxiv - Neuroscience 2021Quote: ... The plasmids were obtained from Addgene (Plasmid#50477 and Plasmid#114469) and packaged by Vigene after in house plasmid preparation ...
-
bioRxiv - Biophysics 2021Quote: ... The LC3-mEYFP plasmid was generated by inserting mEYFP from an mEYFP-C1 vector into pmRFP-LC3 (58) (a gift from Tamotsu Yoshimori, Addgene plasmid # 21075, encoding rat LC3) using digestion with NheI and BglII ...
-
bioRxiv - Cancer Biology 2019Quote: ... Packaging plasmids psPAX2 (Addgene plasmid # 12260) and pMD2.G (Didier Trono ...