Labshake search
Citations for Addgene :
351 - 400 of 2756 citations for Mouse Anti Human Immunodeficiency Virus HIV 1 gp41 1911 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2021Quote: ... Cre-positive mice received the AAV-hM4D injection (test mice) or a control virus AAV-YFP (Addgene) (control mice) ...
-
bioRxiv - Neuroscience 2020Quote: ... we injected ∼0.5 μl of retrograde adeno-associated virus expressing tdTomato51 (retroAAV-tdTomato, Addgene Cat# 59462-AAVrg) into the right ACC (bregma +1.2 mm ...
-
bioRxiv - Neuroscience 2020Quote: All optogenetic behavioral manipulations were conducted with bilateral virus injections of AAV2-hSyn-ChR2-EYFP (500nL, Addgene) into either ALM (AP 2.90 ...
-
bioRxiv - Neuroscience 2022Quote: ... we infected the neurons with the retrograde virus pGP-AAVrg-syn-jGCaMP7s-WPRE (Addgene, Plasmid #104487-AAVrg). Injections (450 μL ...
-
bioRxiv - Neuroscience 2022Quote: ... A small volume (0.4 μl total) of virus (AAV8-EF1α-CreOn/FlpOn-GCaMP6f (RRID:Addgene_137122, titer 6.10E+13) for Aldh1a1-iCre/Th-Flpo and VGlut2-IRES-Cre/Th-Flpo mice ...
-
bioRxiv - Neuroscience 2022Quote: ... Cre-positive mice received the AAV-ChR2 injection (test mice) or a control virus AAV-YFP (Addgene) (control mice) ...
-
bioRxiv - Neuroscience 2022Quote: Tobfl/fl mice were bilaterally injected with Cre-expressing adeno-associated virus AAV1.hSyn.Cre.WPRE.hGH (105553-AAV1, Addgene) to generate hippocampus-specific KO mice ...
-
bioRxiv - Genomics 2022Quote: ... Wild-type (J1) mESCs were transduced with Cas9-blast virus (generated from pLentiCas9-Blast, Addgene ID: 52962) and selected with 10μg/ml blasticidin (InvivoGen ...
-
bioRxiv - Neuroscience 2024Quote: ... The dLight virus (700 nL of AAV5-hSyn-dLight 1.2; Addgene, Watertown, MA; Catalog No.111068-AAV5) was injected unilaterally into the NAc core (in mm ...
-
bioRxiv - Neuroscience 2022Quote: ... DAT-IRES-Cre mice (RRID: IMSR_JAX:027178) were injected with AAV1-CAG-FLEX-GCaMP6f virus (RRID: Addgene_100835). For labelling of SNc Anxa1+ neurons ...
-
bioRxiv - Immunology 2023Quote: ... 0.5 µg of a plasmid encoding the vesicular stomatitis virus G protein (pMD2.G, Addgene plasmid #12259), 0.25 µg of a plasmid encoding for the transactivating protein Rev (pRSV-Rev ...
-
bioRxiv - Cell Biology 2023Quote: ... Virus was generated in HEK293T cells by transfection with the aforementioned transfer vectors and pMDLg (Addgene 12251), pRSV-REV (Addgene 12253) ...
-
bioRxiv - Neuroscience 2023Quote: ... or a control virus (AAV2-hSyn-DIO-EGFP, 100 µL at titer ≥ 3×10¹² vg/mL, Addgene). A subset of the optogenetic L6-CT experiments was done in Ntsr1-Cre-ChR2-EYFP mice ...
-
bioRxiv - Neuroscience 2023Quote: ... 5HT and NPY interneurons in the ACC 200 nl of virus (pAAV-hSyn-DIO-mCherry, Addgene 50459) was injected into the ACC ...
-
bioRxiv - Neuroscience 2023Quote: AAV5.CaMKII.GCaMP6f.WPRE.SV40 was the adeno-associated virus (AAV) used for calcium imaging and was obtained from Addgene at 2.3e13 GC-ml ...
-
bioRxiv - Neuroscience 2023Quote: ... The organoids were transduced with the AAV-hSYN-GFP virus two weeks before DIV70 (Addgene, 105539-AAV1). We dissociated the transduced organoids using papain digestion (Worthington ...
-
bioRxiv - Neuroscience 2023Quote: We injected a conditional GCaMP expressing AAV virus (AAV9:FLEX:GCaMP6s; Addgene Plasmid #:100845; Chen, et al., 2013) in the AOB (Bregma 3.5 ...
-
bioRxiv - Bioengineering 2023Quote: ... Plasmids encoding the spike glycoprotein of vesicular stomatitis virus (VSV-G) and Cas9 were obtained from Addgene (cat ...
-
bioRxiv - Neuroscience 2023Quote: ... Virus expressing gCaMP7f (AAV1-syn-jGCaMP7f-WPRE, stock concentration 3 x 1013 vg/mL, Addgene, 104488-AAV1)53 ...
-
bioRxiv - Neuroscience 2024Quote: ... a total of 0.6 µL of AAV5-Syn-GCaMP6s virus (1.8 × 1013 genome copies per mL, Addgene) was slowly injected by Nanoject III Nanoliter Injector into layer 2/3 motor cortex (1.5 mm anterior from bregma ...
-
Formation of a giant unilocular vacuole via macropinocytosis-like process confers anoikis resistancebioRxiv - Cell Biology 2024Quote: ... The cDNAs for GFP-tagged two FYVE domains of mouse HRS and PH domain of human TAPP1 were obtained from Addgene (#140047 and #161985, respectively) and cloned into the pLVX-IRES-puro vector ...
-
bioRxiv - Neuroscience 2021Quote: ... under the control of the human synapsin-1 gene promoter (AAV-GFP/Cre, 105540-AAV1, pENN.AAV1.hSyn.HI.eGFP-Cre.WPRE.SV40, Addgene, Massachusetts, USA) or with AAV expressing only GFP (AAV-GFP ...
-
bioRxiv - Cell Biology 2020Quote: Specific shRNA1 and shRNA2 targeting human ARID1A were cloned into the pLKO.1-TRC-puro vector (Addgene), separately ...
-
bioRxiv - Genetics 2020Quote: The plasmid that contains the isoform 1 of human DNMT3B (DNMT3B1) was purchased from Addgene (cat # 35522). The DNMT3B1 cDNA was then fused to an N-terminal Flag tag by PCR ...
-
bioRxiv - Biochemistry 2024Quote: Human interferon-induced protein with tetratricopeptide repeats 1 (IFIT1) gene (Gene ID: 3434) was obtained from Addgene in the plasmid vector pET28a_IFIT1 ...
-
bioRxiv - Neuroscience 2019Quote: ... double inverted open (DIO)-reading frame adeno-associated virus (AAV): AAV5-hSyn-DIO-hM4D(Gi)-mCherry (Addgene; #44362) or AAV5-Ef1a-DIO-Cherry (UNC viral vector core ...
-
bioRxiv - Neuroscience 2021Quote: ... 450nl of a mostly anterograde virus containing the Cre recombinase under CamKII promoter to target pyramidal cells (AAV1_CamKII_Cre_SV40, Addgene, USA) was injected into the right MEC (+3.2mm laterally from Lambda along the lambdoid suture and DV -2.5mm from skull level) ...
-
bioRxiv - Neuroscience 2020Quote: ... mice were injected with the virus encoding AAV9.CaMKII.GCaMP6f (pENN.AAV.CamKII.GCaMP6f.WPRE.SV40, gift from James M. Wilson, Addgene viral prep # 100834-AAV9) at the following coordinates ...
-
bioRxiv - Biochemistry 2021Quote: Tobacco Etch Virus protease (TEV) was a gift from Helena Berglund (Addgene plasmid # 125194; http://n2t.net/addgene:125194; RRID:Addgene_125194)40 ...
-
bioRxiv - Neuroscience 2022Quote: ... 70–100 nl of AAV5-CaMKIIa-hChR2(H134R)-EYFP (UNC vector core, Karl Deisseroth virus stock/ Addgene #26969) was injected into either the ventral (AP = −2.8 – −3.1 mm ...
-
bioRxiv - Neuroscience 2021Quote: ... The visual cortex was injected with a total of 2–3 μl of virus solution (1e13 GC/ml) containing AAV9-Syn-GCaMP6s.WPRE.SV40 (Penn Vector Core or Addgene) through a beveled glass micropipette (tip size 10–20 μm diameter ...
-
bioRxiv - Neuroscience 2022Quote: ... 100-200 nl virus solution of 3-5 × 1010 genome copies containing AAV5.gfaABC1d.Lck-GCaMP6f (Addgene, MA, USA) were injected at two or three sites in the craniotomy site at the cerebellar cortex (Vermis Lobule 4/5 ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV-DJ-hSYN1::mTurquoise2 (Produced by Stanford University Neuroscience Gene Vector and Virus Core using Addgene, plasmid #99125), AAV-DJ-hSYN1::mCherry (Stanford University Neuroscience Gene Vector and Virus Core ...
-
bioRxiv - Neuroscience 2024Quote: ... We injected in that region 3x750nL of an adeno-associated virus (AAV) mix of AAV1.Syn.GCaMP (6m: Addgene 100841 or 7f ...
-
bioRxiv - Neuroscience 2023Quote: ... the Cre-dependent construct pAAV_hSyn1-SIO-stGtACR2-FusionRed packaged in an adeno-associated virus (AAV1, #105677-AAV1, Addgene) was injected into primary somatosensory cortex (S1 ...
-
bioRxiv - Neuroscience 2023Quote: ... we performed an additional control experiment in which we injected a cre-dependent mCherry virus (pAACV-hSyn-DIO-mCherry; a gift from Bryan Roth; Addgene plasmid #50459; http://n2t.net/addgene:50459; RRID:Addgene_50459) into the basal forebrain of 3 ChAT-cre mice ...
-
bioRxiv - Neuroscience 2024Quote: Eight-week old male C57BL/6J mice were injected with AAV9-syn-jGCaMP8f-WPRE virus (Addgene #162376-AAV9)(jGCaMP8f ...
-
bioRxiv - Neuroscience 2024Quote: The pAAV-hSyn-DIO-hM4D(Gi)-mCherry (DREADD virus) (4*10^12 gc/ml, Addgene, United States, addgene.org) or pAAV-hSyn-DIO-mCherry (4.2*10^12 gc/ml ...
-
bioRxiv - Neuroscience 2024Quote: ... Recombinant mouse myc-netrin-1 was cloned into pSBI-GN vector (Addgene, 60517) to prepare a stable HEK293 cell line expressing mouse netrin-1.
-
bioRxiv - Cancer Biology 2024Quote: ... Lentiviral vector carrying human HNF4A was made by inserting human HNF4A825 (obtained from Addgene; cat# 31094) into the PGK-IRES-EGFP vector as described previously.26 Lentivirus was generated at the CCHMC viral vector core ...
-
bioRxiv - Developmental Biology 2021Quote: ... GST-human β-catenin (Addgene #24193), and NLS-mCherry (Addgene #49313 ...
-
bioRxiv - Molecular Biology 2022Quote: ... pscALPSpuro-HsACE2 (human) (Addgene, MA, USA) were co-transfected with psPAX2 and pCMV-VSV-G packaging plasmids into HEK293T cells using FuGENE 6 (Promega ...
-
bioRxiv - Cancer Biology 2024Quote: ORF encoding human MARK2 (Addgene, 23404) was cloned into pFL system with an N-terminal Strep2SUMO tag ...
-
bioRxiv - Biochemistry 2024Quote: Recombinant human GST-CK2α’ (Addgene #27084) and recombinant human GST-CK2α (Addgene #27083 ...
-
bioRxiv - Neuroscience 2023Quote: ... human a-SYN (A53T mutant) (Addgene), and mt-Keima (Addgene) ...
-
bioRxiv - Immunology 2020Quote: Soluble human ACE2 with an Fc tag was constructed by PCR amplifying ACE2 (residues 1-615) from Addgene plasmid #1786 (a kind gift from Jesse Bloom ...
-
bioRxiv - Immunology 2022Quote: shRNAs were designed to target human Galectin-9 mRNA and cloned into the pLKO.1 vector (Addgene #10878). The sense shRNA sequences are CCTGGTGCAGAGCTCAGATTT (shGal-9 #1 ...
-
bioRxiv - Cancer Biology 2023Quote: Whole genome CRISPR Screening was performed using the Human CRISPR Knockout Pooled Library (Brunello) - 1 vector system (Addgene and a gift from John Doench to the Functional Genomics Facility at the University of Colorado Anschutz Medical Campus)(44) ...
-
bioRxiv - Neuroscience 2023Quote: The following expression constructs were used: human CaV2.2 (huCaV2.2 (pSAD442-1) was a gift from Diane Lipscombe (Addgene plasmid # 62574 ...
-
bioRxiv - Cancer Biology 2024Quote: ... The pLKO.1 shRNA plasmid targeting human TSC2 was a gift from Do-Hyung Kim (Cat#15478, Addgene). Lentiviral pLKO shRNA plasmids were transiently co-transfected individually along with plasmids encoding ΔVPR and VSV-G into HEK293T cells using TurboFect™ (Cat#R0531 ...