Labshake search
Citations for Addgene :
501 - 550 of 2756 citations for Mouse Anti Human Immunodeficiency Virus HIV 1 gp41 1911 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2020Quote: ... Synthetic and control promoter parts were assembled with the omega 5’ untranslated region from tobacco mosaic virus (5UTR-ΩTMV; pICH41402, Addgene #50285), the coding sequence of firefly luciferase (LucF ...
-
bioRxiv - Neuroscience 2019Quote: ... as described(Wickersham et al., 2015) but with the use of the vesicular stomatitis virus envelope expression plasmid pMD2.G (Addgene 12259) for all vectors except for LV-U-TVA950(B19G) ...
-
bioRxiv - Genetics 2020Quote: ... were transduced at a low multiplicity of infection (MOI) with virus containing sgRNA library cloned in lentiGuide-Puro (Addgene plasmid 52963) to ensure that most cells received only one sgRNA in expansion phase medium42 ...
-
bioRxiv - Neuroscience 2021Quote: ... received a bilateral injection of transsynaptic Cre-inducing anterograde virus (AAV1-hSyn-Cre-WPRE-hGH, Penn Vector Core via Addgene, V24784) mixed with a Cre-dependent tdTom-expressing reporter virus to visualize injection sites (AAV2-Ef1a-flex-tdTomato ...
-
bioRxiv - Neuroscience 2022Quote: ... P1 Syngap1+/fl mice were injected with an rAAV9-packaged Cre-GFP expressing virus (pENN.AAV.CamKII.HI.GFP-Cre.WPRE.SV40: Addgene #105551-AAV9: Titer = 5.66×1013 GC/ml) via the superficial temporal vein (STV ...
-
bioRxiv - Neuroscience 2022Quote: ... P1 Syngap1+/fl crossed to Ai9 mice were injected with an rAAV9-packaged Cre-expressing virus (pENN.AAV.hSyn.Cre.WPRE.hGH; Addgene # 105553-AAV9; Titer 2.3 x 1013). Briefly ...
-
bioRxiv - Neuroscience 2022Quote: ... or Syngap1+/fl expressing the Ai9 Cre reporter allele were injected with a rAAV9-packaged Cre-expressing virus (pENN.AAV.hSyn.Cre.WPRE.hGH; Addgene # 105553-AAV9; Titer 2.3 x 1013), via STV injection described previously ...
-
bioRxiv - Genomics 2022Quote: All CRISPRi effectors were cloned into a lentiviral backbone containing a ubiquitous chromatin opening element and a spleen focus forming virus (SFFV) promoter (pMH0001, Addgene # 85969). Briefly ...
-
bioRxiv - Cancer Biology 2024Quote: ... B7GG cells were transfected by Lipofectamine 3000 (Thermo Fischer) with rabies virus genomic vectors RabV CVS-N2cΔG-eGFP (Addgene plasmid #73461) or SAD-B19ΔG-eGFP (modified from Addgene plasmid # 32634) ...
-
bioRxiv - Neuroscience 2024Quote: ... 200 μL of the viral cocktail AAV5-CamKIIa-C1V1(E122T/E162T)-TS-eYFP-WPRE-hGH (2.5 × 1012 virus molecules/mL; Penn Vector Core, University of Pennsylvania, PA, USA, Addgene number: 35499) was administered across four sites into the primary somatosensory (S1 ...
-
bioRxiv - Neuroscience 2023Quote: ... was achieved through the bilateral stereotaxic injection of an Adeno-Associated virus containing a cre-recombinase enzyme (AAVpmSyn1-EBFP-Cre, Addgene#51507) into the OB of Ghsrfl/fl∷Ai14 RFP (designated OBGHSR−/− ...
-
bioRxiv - Cell Biology 2023Quote: A synthetic sequence corresponding to 2A peptide from Thoseaasigna virus capsid protein and BspTI (AflII) restriction site was first cloned to pCXLE-EGFP (Plasmid #27082, Addgene, www.addgene.org) (Okita et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... Male PV-Cre and both male and female Ai6 mice were secured in a stereotaxic frame and bilateral injections of 200-300 nl AAV1 virus vectors (AAV1-EF1a-DIO-ChETA-eYFP (Addgene: 26968) to PV-Cre mice and pENN-AAV1-hSyn-Cre-WPRE-hGH (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: ... into the AC and a retrograde Cre virus: pENN/AAVrg-hSyn-Cre-WPRE-hGH (1.8E+13 vg/ml, 200nl, Addgene catalog #105553) into the pStr ...
-
bioRxiv - Neuroscience 2023Quote: ... We bilaterally injected Cre-dependent DREADD virus (Roth, 2016): AAV5-hSyn-DIO-hM4D(Gi)-mCherry (2.4E+13 vg/ml, 350nl, Addgene catalog # 44362) or AAV5-hSyn-DIO-mCherry (2.6E+13 vg/ml ...
-
bioRxiv - Neuroscience 2023Quote: ... We expressed the soma-targeted opsin ST-ChrimsonR 43 in excitatory neurons by injecting a virus (1012 titer; AAV2/2 camKII-KV2.1-ChrimsonR-FusionRed; Addgene, plasmid #102771) into the craniotomy ...
-
bioRxiv - Immunology 2024Quote: ... Lentivirus was produced using standard virus production methods by co-transfecting target and packaging plasmids (psPAX2 – Addgene12260 and pMD2.G-Addgene 12259) into HEK293T cells ...
-
bioRxiv - Neuroscience 2024Quote: A bicistronic virus expressing both opsin and GCaMP indicator, AAV9-hSyn-DIO-jGCaMP8s-P2A-stChrimsonR(LaFosse et al., 2023) (Addgene, 174007) was diluted in phosphate-buffered saline (final titer ...
-
bioRxiv - Cell Biology 2022Quote: ... having N of human coronavirus OC43 and pGBW-m4134901 (plasmid number 151922) having N of human coronavirus HKU1 229E were obtained from Addgene. Those N expression vectors were subcloned into pcDNA3.1 with C-terminal flag or EGFP tag ...
-
bioRxiv - Cancer Biology 2022Quote: ... encoding human KDM6A with HA tag and pCS2-UTX-F-MT2 (40619) encoding enzyme-dead human KDM6A were purchased from Addgene. The HR and NHEJ reporter plasmids were kind gifts from Tomasz Skorski (61) ...
-
bioRxiv - Cancer Biology 2021Quote: The human MYC cDNA was purchased from Addgene (pDONR223_MYC_WT ...
-
bioRxiv - Molecular Biology 2019Quote: ... and a human codon-optimized Cas9 (Addgene 41815) were co-nucleofected into target cells by nucleofection (Lonza apparatus) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human ETV1 (Addgene, Cambridge, MA, USA; plasmid #82209) and ETV5 (Horizon Discovery ...
-
bioRxiv - Biochemistry 2020Quote: Plasmids encoding human full-length WDR5 (2GNQ, Addgene) or a 20aa N-terminal truncation (ΔN20 ...
-
Nonsense Mediated RNA Decay Is a Unique Vulnerability of Cancer Cells with SF3B1 and U2AF1 MutationsbioRxiv - Cell Biology 2021Quote: Human GeCKOv2 CRISPR knockout pooled library (Addgene # 1000000049) and lenti-Cas9 plasmid were obtained from addgene (Addgene # 52962) ...
-
bioRxiv - Neuroscience 2021Quote: Heterologous expression of human NaV1.2 WT (Addgene #162279)(DeKeyser et al. ...
-
bioRxiv - Cancer Biology 2021Quote: ... human TERT (LOX-TERT-iresTK; Addgene plasmid #12245), generously provided by Didier Trono ...
-
bioRxiv - Neuroscience 2022Quote: ... Human VAC14 was obtained from Addgene (Plasmid #47418) and subcloned into the mCherry- C1 vector ...
-
bioRxiv - Biochemistry 2022Quote: ... Human BIN1-EGFP (isoform 8) (Addgene plasmid #27305) was cloned in pET15b with N-terminal 6xHis and C-terminal StrepII tags ...
-
bioRxiv - Microbiology 2023Quote: The human SAM CRISPRa sgRNA library (Addgene #1000000078) was cloned into the pHW-TRPPC-NS rescue plasmid backbone for PR8 (Fig S2A ...
-
bioRxiv - Biophysics 2023Quote: Human MeCP2 in the pTXB1 plasmid (Addgene #48091) was propagated in E ...
-
bioRxiv - Immunology 2023Quote: A lentiviral construct containing human ACE2 (Addgene 155295) or mScarlet (Addgene 85044 ...
-
bioRxiv - Physiology 2023Quote: ... containing human Fis1 gene were purchased from Addgene. The working viral vectors were constructed from these two plasmids by Custom DNA Constructs ...
-
bioRxiv - Biochemistry 2023Quote: Human BIN1-EGFP (isoform 8) (Addgene plasmid #27305) and human dynamin2 C-terminally tagged to mCherry were cloned in pET15b with an N-terminal 6xHis and a C-terminal StrepII tag ...
-
bioRxiv - Neuroscience 2024Quote: Flag-Human CXCR7(ACKR3)-Tango (Plasmid #66265, Addgene) immune-purification was performed as described in 87 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tetracycline-inducible TET-shRB1 and constitutive shRB1 constructs were created by integrating validated siRNA sequences GAAAGGACATGTGAACTTA (63) and GAACGATTATCCATTCAAA (64) targeting human RB1 (shRB1) into TET-pLKO.1-Puro vector (Addgene #21915) and pLKO.1-Puro vector ...
-
bioRxiv - Cancer Biology 2021Quote: ... plasmids were created by integrating validated siRNA sequences CCTGTCAGGAAACTGTATGAT (62) and AATGGCCATCAGAACGGACTT targeting human ESRRG (shESRRG) into pLKO.1-Puro vector (Addgene #8453). Non-specific siRNA sequence AACAGCCACAACGTCTATATC or siRNA sequence CAACAGCCACAACGTCTATAT targeting GFP were used as controls for shRNA ...
-
bioRxiv - Cancer Biology 2022Quote: The human NOTCH 1 intracellular domain (h1NICD) doxycycline-inducible expression plasmid (pLIX-h1NICD) was a gift from Julien Sage (Addgene #91897)11 ...
-
bioRxiv - Immunology 2024Quote: Stable Cas9 expression was established in human B-cell lines (WSU-FSCCL, HBL-1 and SUDHL5) using lentiviral transduction of lentiCas9-Blast (Addgene #52962). Cells were incubated with 10µg/ml polybrene (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2020Quote: ... and the matrix protein from vesicular stomatitis virus was amplified from pVSV eGFP dG (a gift from Connie Cepko; Addgene plasmid #31842) as described above using the primers listed in Table S2 ...
-
bioRxiv - Microbiology 2021Quote: The Tobacco mosaic virus (TMV) expression vector pJL-TRBO has been previously described [57] and was a gift from John Lindbo (Addgene plasmid # 80082). The TMV vector containing p26:GFP has also been previously described [41] ...
-
bioRxiv - Immunology 2019Quote: ... We used the resulting virus particles to transduce immortalized wild-type C57BL/6 cells that express doxycycline-inducible SpCas9 enzyme (generated using Addgene plasmid #50661). We cultured transduced cells in 3.0 μg/ml blasticidin (Invivogen ...
-
bioRxiv - Genomics 2022Quote: ... BPTF BD with an N-terminal 6xHistidine (6His) tag and Tobacco Etch Virus (TEV) Protease cleavage site was from Addgene (plasmid 39111). This was modified using the Q5 Site-directed mutagenesis kit (New England Biolabs [NEB] ...
-
bioRxiv - Neuroscience 2022Quote: ... into the OB and the retrograde virus AAVrg-CamKIIα-mCherry (80 µl at titer ≥ 7×10¹² vg/mL, #114469-AAVrg, Addgene, MA, USA) into the HP ...
-
bioRxiv - Cell Biology 2019Quote: ... Tetracycline-inducible MYH12A WT and S1AS2A-mutant IA32 cell lines were made by first preparing a stable rtTA-expressing IA32 cells using pLenti-CMV-rtTA3-hygro lentivirus infection (virus made with Addgene plasmid 26730) and selection with 100 μg/mL hygromycin ...
-
bioRxiv - Bioengineering 2019Quote: ... H9 GFP hESC line was generated by infecting H9 hESCs with pLenti PGK GFP Puro virus generated from the plasmid purchased from AddGene (Cat#: 19070)(Campeau et al. ...
-
bioRxiv - Pathology 2020Quote: ... Lentiviral vector pLV-mCherry and vesicular stomatitis virus glycoprotein (VSV-G) expression vector pMD2.G were obtained from Addgene (Watertown, MA, USA). Coding sequence of SARS-CoV-2 S gene (GenBank ...
-
bioRxiv - Neuroscience 2021Quote: The CVS N2cdG-H2B-EGFP rabies virus was generated by replacing GFP in the rabies genomic plasmid RabV CVS-N2c(deltaG)-EGFP (Addgene, Plasmid #73461) with H2B-EGFP flanked by 5’ XmaI and 3’ NheI-KasI sites ...
-
bioRxiv - Neuroscience 2021Quote: The SAD B19dG-H2B-EGFP virus was generated by inserting the H2B-EGFP sequence into the gG locus of the pSADdeltaG-F3 plasmid (Addgene, Plasmid #32634). The EnvA SAD B19dG-H2B-EGFP rabies viruses were generated from the genomic plasmid as described previously2 ...
-
bioRxiv - Neuroscience 2020Quote: ... Non-Cre-dependent expression of hM4D(Gi) was mediated by administration of an AAV8-CaMKIIa-hM4D(Gi)-mCherry virus (Addgene; plasmid #50477) while that of a GFP reporter by administration of an AAV5-CaMKII-GFP virus (Boyden ...