Labshake search
Citations for Addgene :
351 - 400 of 2674 citations for 7 Oxabicyclo 4.1.0 heptane 2 carboxylicacid 6 ethyl 1 methyl 5 oxo ethylester 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... mKeima-Red-Mito-7 was a gift from Michael Davidson (Addgene plasmid # 56018; http://n2t.net/addgene:56018; RRID:Addgene_56018) Transfections have been performed with Lipofectamin 3000 (Thermofisher ...
-
bioRxiv - Biophysics 2023Quote: ... The pT7-7 aSyn C141 plasmid was a gift from Gabriele Kaminski Schierle (Addgene plasmid #108866; RRID: Addgene_108866). After lysis with boiling ...
-
bioRxiv - Developmental Biology 2023Quote: ... TdTomato-LifeAct tdTomato-Lifeact-7 was a gift from Michael Davidson (Addgene plasmid # 54528 ; http://n2t.net/addgene:54528 ; RRID:Addgene_54528). Primers for all subcloned constructs are shown in Supplementary Table 8 ...
-
bioRxiv - Biochemistry 2023Quote: The pT7-7 α-syn WT plasmid (a gift from Hilal Lashuel, Addgene, Watertown, NY, United States (61)) ...
-
bioRxiv - Biophysics 2023Quote: ... The pT7-7 aSyn C141 plasmid was a gift from Gabriele Kaminski Schierle (Addgene plasmid #108866; RRID: Addgene_108866). After lysis with boiling ...
-
bioRxiv - Neuroscience 2024Quote: ... or pAAV-hSyn-EGFP a gift from Bryan Roth (titer ≥ 7×10¹² genome copies per ml; Addgene viral prep # 50465-AAV1; http://n2t.net/addgene:50465; RRID:Addgene_50465) were injected into the dorsolateral (100-200 nl ...
-
bioRxiv - Cell Biology 2024Quote: ... mEmerald-Lifeact-7 was a gift from Michael Davidson (Addgene plasmid # 54148 ; http://n2t.net/addgene:54148 ; RRID:Addgene 54148) For protein depletion ...
-
bioRxiv - Cell Biology 2022Quote: ... CRISPR vector pX330A-1×2 was a gift from Takashi Yamamoto (Addgene plasmid # 58766 ; http://n2t.net/addgene:58766 ; RRID:Addgene_58766) (101) ...
-
bioRxiv - Neuroscience 2020Quote: ... from pBS-KS-attB2-SA(0/1/2)-T2A-LexA::QFAD-Hsp70 plasmids (Addgene #62947, #62948 and #62949) (Diao et al. ...
-
bioRxiv - Neuroscience 2021Quote: AAV1/2.hSyn-GFP particles were generated by co-transfection of HEK293T cells with AAV2/1 (Addgene 112862), AAV2/2 (Addgene 104963) ...
-
bioRxiv - Cell Biology 2020Quote: ... dlg-1::mCherry and ebp-2::egfp vectors were cloned using Gibson assembly and vector pJJR82 (Addgene #75027) (Gibson et al. ...
-
bioRxiv - Biochemistry 2023Quote: ... The SARS-CoV-2 Spike ectodomain Hexa-pro construction (Table 1) was a gift from Jason McLellan (Addgene # 154754 ...
-
Linear ubiquitination at damaged lysosomes induces local NF-κB activation and controls cell survivalbioRxiv - Cell Biology 2023Quote: ... GFP as non-human target (NHT) control (5’-GGAGCGCACCATCTTCTTCA-3’, 5’-GCCACAAGTTCAGCGTGTC-3’, and 5’-GGGCGAGGAGCTGTTCACCG-3’) cloned into pLentiCRISPRv2 (Addgene, 52961, deposited by Feng Zhang). To generate lentiviral particles ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV2/2 (Addgene 104963), adenovirus helper plasmid pAdDeltaF6 (Addgene 112867 ...
-
bioRxiv - Microbiology 2020Quote: ... The plentiCRISPRV.2 (Addgene) was digested with BsmBI and ligated with guide RNA sequences specific for IFNAR1 ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV2/2 (Addgene #104963), pAAV2/5 (Addgene #104964) ...
-
bioRxiv - Microbiology 2021Quote: ... 10 μg of pEA216-1 was then co-transfected with 5 μg of the pCMVΔR8.2 helper plasmid (Addgene Plasmid #122263) and 1 μg of pHEF-VSV-G into 70% confluent monolayers of 293T cells in a 10 cm dish using polyethylenimine (Polysciences Inc ...
-
bioRxiv - Immunology 2021Quote: ... par-5 and his-1 cDNA were subcloned into pCE-BiFC-VN173 and pCE-BiFC-VC155 plasmids (Addgene, Cambridge, MA), which contain the heat shock promoter Phsp-16.41 ...
-
bioRxiv - Neuroscience 2020Quote: The DNA fragment of H2B-mEos4b-6 (a gift from Michael Davidson (Addgene plasmid # 57508 ...
-
bioRxiv - Cell Biology 2020Quote: ... YFP-Parkin was a gift from Richard Youle (Addgene plasmid #23955)6 and EGFP-LC3 was a gift from Karla Kirkegaard (Addgene plasmid #11546)7 ...
-
bioRxiv - Neuroscience 2023Quote: ... was injected AAV1.Syn-GCaMP6m (pAAV.Syn.GCaMP6m.WPRE.SV40 from Addgene, #100841, titer 6-8 ✕ 1012). To express tdTomato in GABAergic neurons ...
-
bioRxiv - Genomics 2024Quote: ... and 6 were generated from pSpCas9(BB)-2A-Puro (PX459 V2.0, Addgene #62988) via insertion of spacer sequences into the BbsI cloning site (#R3539L ...
-
bioRxiv - Cell Biology 2019Quote: ... Lamin A-mEmerald (mEmerald-LaminA-N-18) and NLS-mCherry (mCherry-Nucleus-7) were gifts from Michael Davidson (Addgene plasmids #54139 and #55110 ...
-
bioRxiv - Biophysics 2022Quote: ... The plasmid MApple-LC-Myosin-N-7 was a gift from Michael Davidson (Addgene plasmid 54920; http://n2t.net/addgene : 54920; RRID : Addgene_54920). The plasmid MCherry-Actin-C-18 was a gift from Michael Davidson (Addgene plasmid 54967 ...
-
bioRxiv - Neuroscience 2021Quote: ... over V1 using an ultrafine dental drill and inserted a glass pipette backfilled with AAV2.1-EF1a-double floxed-hChR2(H134R)-EYFP-WPRE-HGHpA (titer: 7×1012 vg/mL, 20298-AAV1 Addgene). In total 50 nL was injected in V1 (bilateral binocular V1 for Task A and unilateral V1 for Task B ...
-
bioRxiv - Neuroscience 2022Quote: ... or AAVrg-hSyn-DIO-hM3D(Gq)-mCherry (titer >7×1012 vg/ml, viral prep #44361-AAVrg, Addgene, US,68). For canine adenovirus (CAV ...
-
bioRxiv - Biophysics 2019Quote: ... This α-actinin1-SNAP-His fragment was introduced downstream of the T7 promoter of pET T7-7 plasmid (Addgene).
-
bioRxiv - Biochemistry 2021Quote: The guide RNA sequence CAGAATTGGCGCTATGCTAC targeting exon 7 of FUT8 was cloned into px458 pSpCas9(BB)-2A-GFP (Addgene). The resulting plasmid was transfected into Huh7 cells using ViaFect (Promega ...
-
bioRxiv - Neuroscience 2021Quote: ... AAVrg-CAG-GFP (titer ≥ 7×1012vg/mL, category number 37825, lot V9234) was purchased from Addgene (Watertown, MA, USA).
-
bioRxiv - Bioengineering 2022Quote: ... To generate H2B-iRFP lentiviral particles HEK 293T cells were plated in a 6-well plate (7×105 cells per well) and transiently transfected with 1.5 μg of pLenti-pGK-DEST-H2B-iRFP vector (Addgene # 90237 ...
-
bioRxiv - Cell Biology 2022Quote: ... The plasmids used in this study were as follows: YFP-Mito-7 was a gift from Michael Davidson (Addgene plasmid # 56596 ...
-
bioRxiv - Neuroscience 2023Quote: Adult mice were stereotaxically injected at 7-10 weeks of age with 600 nl of 1.5×1013 vg/ml AAV1-CKIIa-stGtACR2-FusionRed (AddGene) or 7×1012 vg/ml AAV1-CKIIa-mCherry control at bilateral ACC (antero-posterior (AP ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... experimental animals received bilateral infusions (0.5 µL/hemisphere) of AAV5-hSyn-DIO-hM3D(Gq)-mCherry (7×1012 vg/mL; Addgene) into the VTA as described in [32] ...
-
bioRxiv - Developmental Biology 2023Quote: Full length fmi cDNA from UAS-fmi (ref 7) was subcloned in two EcoR1-Xho1fragments into pQUAST (#24349; Addgene) and transformed into w1118 flies to generate random genomic insertions.
-
bioRxiv - Cell Biology 2021Quote: ... and AAV packaging plasmid expressing Rep2/Cap5 genes for production of serotype 5 – pAAV2/5 (RRID:Addgene_104964).
-
bioRxiv - Neuroscience 2024Quote: ... we obtained the AAV2/5 virus of the GFAP -tdTomato vector from Addgene (#44332-AAV2/5). Titers ranged from 1-4 x 1013 vg/mL.
-
bioRxiv - Plant Biology 2022Quote: ... pICH41402 (Addgene #50285; ΩTMV 5’UTR), pAGM47523 (Addgene #153221 ...
-
bioRxiv - Biophysics 2022Quote: ATG12–5-16L1-GFP constructs (Addgene_169077) were expressed and purified from SF9 cells as described25 (dx.doi.org/10.17504/protocols.io.br6qm9dw) ...
-
bioRxiv - Immunology 2019Quote: ... pCMV-DR8.2 (5 ng, Addgene #12263) and 2.5 μg of the lentiviral vector ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5 μg of VSV.G (#14888, Addgene) and 5 μg pCL-Eco (#12371 ...
-
bioRxiv - Neuroscience 2022Quote: ... titer: 5 × 1012 GC/ml (Addgene viral prep # 18917-AAV1 ...
-
bioRxiv - Neuroscience 2023Quote: ... or AAV2/5.EF1a-eYFP.WPRE.hGH (Addgene, titer ≥ 7×10¹2 vg/mL ...
-
bioRxiv - Cell Biology 2023Quote: ... and 5 μg pMD2G (12259; Addgene) using Lipofectamine 2000 according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 µg of pMDLg/pRRE (Addgene 12251 ...
-
bioRxiv - Neuroscience 2019Quote: ... the inhibitory channelrhodopsin stGtACR2 (soma-targeted Guillardia theta anion-conducting channelrhodopsin 2, pAAV_hSyn1-SIO-stGtACR2-FusionRed, titer > 1 x 1013 particles/mL, Addgene). The vectors were injected (0.5 µl each side ...
-
bioRxiv - Developmental Biology 2021Quote: ... Two guides were designed using the http://crispr.mit.edu tool (guide 1: CGGCTACTCCACTGTGGCGG; guide 2: CGCTTCTTGGGCCGGATGAG) and were cloned into the pX458 plasmid (Addgene, #48138) as previously described (55) ...
-
bioRxiv - Genomics 2022Quote: pNLZ10 (Pfib-1::NLS::dCas9::24xGCN4::NLS::tbb-2 3’UTR) construct contains pCFJ150 vector backbone (Addgene plasmid # 19329). SV40 NLS::dCas9::egl-13 NLS: ...
-
bioRxiv - Systems Biology 2022Quote: ... or 1-2 x 105 cells/mL for pCL040-based inducible protein expression vectors (to be deposited on Addgene) to account for differences in infection efficiency ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 μl and 500 nl of AAV9-hSyn-GRAB-rDA1m (2 x 10^13 vg/ml; Addgene, 140556-AAV9) were injected into the dorsal striatum (AP 0.5 mm ...
-
bioRxiv - Cancer Biology 2023Quote: ... HEK 293T cells were transfected with either sulfatase 1 or sulfatase 2 expression plasmids or empty vector control derived from pcDNA3.1 (RRID: Addgene_79663) using Lipofectamine 3000 (Thermo Fisher Scientific) ...