Labshake search
Citations for Addgene :
201 - 250 of 2674 citations for 7 Oxabicyclo 4.1.0 heptane 2 carboxylicacid 6 ethyl 1 methyl 5 oxo ethylester 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... and envelope (6 μg pMD2.G, Addgene #12259) viral plasmids were diluted in 500 μL serum-free DMEM ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 6 μg of psPAX2 (Addgene, Cat #12260) into a 10 cm plate of HEK293T cells at 60-70% using Fugene 6 transfection reagent (Promega ...
-
bioRxiv - Cell Biology 2019Quote: ... mCherry-Golgi-7 was a gift from Michael Davidson (Addgene plasmid: no. 55052) and the cassette was subcloned into a pCSIIbsr vector ...
-
bioRxiv - Cell Biology 2021Quote: Mito-Emerald (mEmerald-Mito-7) was a gift from Michael Davidson (Addgene #54160) 43 ...
-
bioRxiv - Biochemistry 2022Quote: pT7-7 WT α-syn construct (Addgene, USA, gifted from Hilal Lashuel [34]), was transformed into BL21-Gold (DE3 ...
-
bioRxiv - Cell Biology 2019Quote: ... The plasmid mAzurite-Actin-7 (a gift from Michael Davidson Addgene plasmid 55227) was modified by incorporating the M2×24 array with 5’ XbaI and 3’ BclI sites ...
-
bioRxiv - Cancer Biology 2019Quote: mTagRFP-T-Fibrillarin-7 was a gift from Michael Davidson (Addgene plasmid # 58016); GFP-Nucleolin from Michael Kastan (Addgene plasmid # 28176 ...
-
bioRxiv - Physiology 2022Quote: ... cells were transfected with 1μg DsRed2-Mito-7 (Mito-dsRed) (Addgene Plasmid #55838) by lipofectamine (Invitrogen L3000008 ...
-
bioRxiv - Cell Biology 2023Quote: ... Soluble mCherry (pmCherry-N3 plasmid) was cloned from pmCherry-mito-7 (Addgene #55102).
-
bioRxiv - Cell Biology 2024Quote: ... gene targeting sgRNAs (Supp Table 7) were cloned into pX459 (Addgene plasmid #48139) using BbsI (NEB ...
-
bioRxiv - Microbiology 2023Quote: ... ATG16L1 shRNA (5’-GTCATCGACCTCCGGACAAAT-3’) was inserted into pLKO.1 puro (Addgene plasmid #8453) to generate pLKO.1-ATG16L1-shRNA ...
-
bioRxiv - Cancer Biology 2023Quote: ... sh2: 5-CCAACAACATCTTCTGCTCC-3’ were cloned into the lentiviral vector pLKO.1 (Addgene #8453)[16] ...
-
bioRxiv - Cancer Biology 2023Quote: ... the murine shRNA hairpins pLKO.1-shCdkn2a #1 (TRCN0000077816) and #2 (TRCN0000362595) and the human and murine pLKO.1-shGFP control (Addgene, cat#30323) vectors were packaged using the ViraPower Kit (Invitrogen ...
-
bioRxiv - Biophysics 2021Quote: ... a pRSFDuet-1 plasmid containing His6-SUMO SARS-CoV-2 nsp12 (Addgene #159107) was transformed into E ...
-
bioRxiv - Biophysics 2021Quote: ... the pCDFDuet-1 plasmid containing His6 SARS-CoV-2 nsp7/8 (Addgene #159092) was transformed into E ...
-
bioRxiv - Biophysics 2022Quote: ... the pCDFDuet-1 plasmid containing His6 SARS-CoV-2 nsp7/8 (Addgene #159092) was transformed into E ...
-
bioRxiv - Genetics 2019Quote: pCFD3-frame_selector_(0, 1, or 2) plasmids (Addgene #127553-127555, DGRC #1482-1484) were cloned by ligating annealed oligos encoding sgRNAs that target the CRISPaint target site (Schmid-Burgk et al ...
-
bioRxiv - Neuroscience 2021Quote: ... 500–550 nl of AAV9-Syn-jGCaMP7f-WPRE virus (diluted 1:2; Addgene) was injected in dorsal CA1 to express synapsin-driven calcium sensor jGCaMP7f (injection coordinates ...
-
bioRxiv - Cell Biology 2022Quote: ... 1–2 (lenti-TRE3G-ApaLI(*)-Hygro) were cloned into LT3REVIR (Addgene Plasmid #111176) by inserting mito-ApaLI(* ...
-
bioRxiv - Neuroscience 2023Quote: ... diluted to 1/2) or AAV-Ef1a-mCherry (#114470-AAV9, obtained from Addgene; titer ...
-
bioRxiv - Cell Biology 2023Quote: ... YAP-targeting shRNA vectors 1 and 2 refer to pLKO1-shYAP1 (Addgene, #27368) and pLKO1-shYAP2 (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: ... 0.50 µL of AAV5.FLEX.ArchT.tdTomato (diluted 1:2 with dPBS; Addgene number: 28305) was injected in basal forebrain of ChAT-Cre animals using the coordinates described above ...
-
bioRxiv - Cancer Biology 2022Quote: ... and exon 5: AGCCCAAGGATGCCAGCCAG (guide 2) were ordered from IDT (Leuven, Belgium) and cloned into pSpCas9(BB)-2A-GFP(PX458) (Addgene Teddington, UK), according to the protocol of Ann Ran et al ...
-
bioRxiv - Developmental Biology 2023Quote: ... sgRNAs 5’-CCCCATGGACATACCCACTG-3’ and 5’-CCAGTCGAGCAGAAAAGTGT-3’ defining a 244 bp region in Nodal exon 2 were cloned into pX458 (Addgene plasmid #48138) or pX459 (Addgene plasmid #48139 ...
-
bioRxiv - Neuroscience 2020Quote: Stereotaxic injection of AAV-EF1a-DIO-HChR2(H134R)-eYFP (serotype 2/1 or 2/9, U. Penn Vector Core, Philadelphia, PA, USA or Addgene, Watertown, MA, USA) was performed in 6-8 weeks old DAT-IRES-Cre or FoxP2-Cre transgenic mice ...
-
bioRxiv - Immunology 2021Quote: ... HEK293T cells were seeded in 6-well plates and the next day transfected with 1 μg psPAX2 packaging plasmid (Addgene 12260), 500 ng pMD2.G VSV-G envelope plasmid (Addgene 12259 ...
-
bioRxiv - Genomics 2022Quote: ... Each 15-cm2 plate was transfected with a total of 21 μg of plasmid DNA (1:2:1 ratio psPAX2-D64V:pLenti-STARR:pLAI-Env) [psPAX-D64V (Addgene #63586), and pLAI-HIV (Addgene #133996)] ...
-
bioRxiv - Neuroscience 2023Quote: ... 0.25 µL of EnvA G-Deleted Rabies-mCherry (diluted 1:5 in dPBS; Addgene: 32636) was injected in the basal forebrain using the same coordinates ...
-
bioRxiv - Cell Biology 2020Quote: ... and pT7-7 α-Syn A53T (Addgene plasmid #10572737; http://n2t.net/addgene:105727; RRID:Addgene_105727) (gift from Hilal Lashuel).
-
bioRxiv - Neuroscience 2022Quote: ... we injected AAV1-CAG-FLEXFRT-ChR2(H134R)-mCherry (75470, 7×1012 vg/mL, Addgene). For imaging DA dynamics ...
-
bioRxiv - Biophysics 2022Quote: ... The plasmid MApple-LC-Myosin-N-7 was a gift from Michael Davidson (Addgene plasmid 54920 ...
-
bioRxiv - Cell Biology 2019Quote: ... mEmerald-Vimentin-7 and F-tractin-EGFP were gifts from Michael Davidson (Addgene; 54299) and Dr ...
-
bioRxiv - Biophysics 2022Quote: ... mApple-Lifeact-7 (denoted Lifeact-mApple here) was a gift from Michael Davidson (Addgene plasmid # 54747 ...
-
bioRxiv - Developmental Biology 2019Quote: ... Nslmb-vhhGFP4 coding sequence was amplified from pcDNA3-NSlmb-vhhGFP4 (Addgene plasmid #35579, (7)) by PCR and cloned into pCS2+ plasmid by Gibson assembly.
-
bioRxiv - Cell Biology 2020Quote: Plasmids for the expression of recombinant α-Syn were: pT7-7 α-Syn (Addgene plasmid #3604636 ...
-
bioRxiv - Biophysics 2020Quote: ... The plasmid MApple-LC-Myosin-N-7 was a gift from Michael Davidson (Addgene plasmid # 54920 ...
-
bioRxiv - Neuroscience 2021Quote: ... or AAV5-hSyn-eGFP (titer ≥ 7×1012 vg/mL; Addgene viral prep #50465-AAV5) as control ...
-
bioRxiv - Microbiology 2022Quote: Several plasmids were a kind gift from Nevan Krogan [7] (ORF8-Strep (Addgene #: 141390), Spike-Strep ...
-
bioRxiv - Cell Biology 2023Quote: ... The plasmid MApple-LC-Myosin-N-7 was a gift from Michael Davidson (Addgene plasmid 54920 ...
-
bioRxiv - Bioengineering 2023Quote: ... An existing plasmid was used for the expression of all 7 chaperones (Addgene #197589). For generating the DRUM or DRUMmut stable cell lines ...
-
bioRxiv - Neuroscience 2023Quote: ... Approximately 0.2uL of pAAV5-hSyn-hM4D(Gi)-mCherry (≥ 7 x 1012vg/mL, Addgene # 50475), pAAV5-hSyn-mCherry (≥ 7 x 1012vg/mL ...
-
bioRxiv - Neuroscience 2023Quote: ... or AAV-hSyn-DIO-mCherry (400 nl at titer 7×1012, Addgene, #50459-AAV5) as control ...
-
bioRxiv - Biochemistry 2020Quote: ... Human ACE2 plasmid was obtained from Addgene (#1786, (6)) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 6 μg of psPAX2 packaging plasmid (Addgene plasmid #12260), and 2 μg pMD2.G envelope plasmid (Addgene plasmid #12259) ...
-
bioRxiv - Neuroscience 2020Quote: Raphe and RTN glia AAV-5: pZac2.1 gfaABC1D-cyto-GCaMP6f at a titre of 1×1013 GC·ml-1 (Addgene, Watertown, MA, USA).
-
bioRxiv - Microbiology 2021Quote: Chemical-genetic screens were initiated by thawing 5 × 1 mL (1 OD600 unit per mL) aliquots of the Mtb CRISPRi library (RLC12; Addgene #163954) and inoculating each aliquot into 19 mL 7H9 supplemented with kanamycin (10 μg/ml ...
-
bioRxiv - Neuroscience 2023Quote: ... were coated with 200 nL of a 1:1 mixture of 5% silk fibers and AAV9.CaMKII.GCaMP6f.WPRE.SV40 (Addgene viral prep # 100834-AAV9), as previously described by 70 ...
-
bioRxiv - Cell Biology 2022Quote: ... Dynamin 2-mTFP1 (or dynamin 1-mTFP1) construct was created by replacing the EGFP tag of dynamin 2-EGFP (or dynamin 1-EGFP, Addgene) with mTFP1 (Addgene) ...
-
bioRxiv - Bioengineering 2022Quote: ... Each shRNA was cloned into the host pLKO.1-puro vector. PLKO-shFOXA1#1 (Cat. #: 70095) and PLKO-shFOXA1#2 (Cat. #: 70096) were obtained from Addgene, and previously used 45 ...
-
bioRxiv - Cell Biology 2023Quote: PARP-1 sgRNAs (#1, GTGGCCCACCTTCCAGAAGC; #2, ATACCAAAGAAGGGAGT-AGC) were synthesized and subcloned into lenti-CRISPR vector (Addgene, pXPR_001, plasmid 49535). Lentiviral vectors were co-transfected into HEK293FT cells with the lentivirus packaging plasmids pVSVg and psPAX2 using FuGENE® HD ...