Labshake search
Citations for Addgene :
351 - 400 of 975 citations for 6 Hydroxymethyl 4 methoxy 5 methyl nicotinic acid methyl ester since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... we used AAV2/9-pAAV-hDlx-hM3Dq-dTomato-Fishell-4 (Addgene, 83897) and AAV2/9-pAAV-hDlx-hM4Di-dTomato-Fishell-5 (Addgene ...
-
bioRxiv - Cell Biology 2024Quote: ... and 4 μg of pMD2.G (gift from Didier Trono, Addgene #12259) plasmids in Opti-MEM (Gibco ...
-
bioRxiv - Biochemistry 2024Quote: Human Drosha isoform 4 and human DGCR8 clones were purchased from Addgene. cDNA encoding different length variants of Drosha were cloned into pFL plasmid and expressed as a N-terminal Dual-strep tag fusion ...
-
bioRxiv - Molecular Biology 2024Quote: ... lenti MS2-P65-HSF1_Hygro (4) was a gift from Feng Zhang (Addgene plasmid # 61426 ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were transfected with plasmids expressing VSV-G (4 μg; Addgene #12259), Gag-Pol (3.375 μg ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were transfected with plasmids expressing VSV-G (4 μg; Addgene #12259), Gag-Pol (3.375 μg ...
-
bioRxiv - Neuroscience 2022Quote: The pCMV-hEAAT2 plasmid encoding the human excitatory amino acid transporter type 2 (EAAT2) was a gift from Susan Amara (Addgene plasmid # 32814 ...
-
bioRxiv - Microbiology 2021Quote: pLenti.GFP.NLuc is a dual GFP/nanoluciferase lentiviral vector based on pLenti.CMV.GFP.puro that contains a GFP/nanoluciferase cassette separated by a picornavirus P2A self-processing amino acid motif cloned into the BamH-I and Sal-I sites (Addgene plasmid #17448 ...
-
bioRxiv - Cell Biology 2020Quote: ... and FLAG-tagged FL human TSC2 (1807 amino acids, UniProtKB/Swiss-Prot accession number P49815- 1) were purchased from Addgene, and pRK7 was subcloned with FLAG-tagged human TBC1D7 (293 amino acids ...
-
bioRxiv - Biochemistry 2023Quote: The coding sequence for amino acids 1-110 of GCP2 were PCR amplified from pACEBac1-gamma-TuSC (a gift from Tarun Kapoor (Addgene plasmid # 178079 ...
-
bioRxiv - Cancer Biology 2024Quote: Truncated CPSF6 containing amino acids 1-358 (CPSF6-358) from human isoform 1 was cloned into the pCW57.1 backbone (Addgene 71782). A hemagglutinin (HA ...
-
bioRxiv - Developmental Biology 2021Quote: ... using program A-30 with 1.6 µg each of GFP and tdTomato circularised targeting vectors and 5 µg single gRNA vector PX459 (5’-TATACCTAATCATTATGCCG-3’) (Addgene, 48139, a gift from Feng Zhang). Homology arms flanking the target site were amplified from genomic DNA and cloned into pBluescript II SK(+ ...
-
bioRxiv - Cancer Biology 2022Quote: ... sgRNA constructs for ANKLE1 knockout were generated by inserting oligonucleotides containing the targeted sequences (5′-TTCAGGGCACAGCCTAGAAC -3′ and 5′-GATTCT-GCCCTAGCCCCACC -3′) into the pX458 vector (Addgene Plasmid #48138 (Ran et al. 2013)) ...
-
bioRxiv - Genetics 2021Quote: ... 5 μg Cas9 expression plasmid pSpCas9(BB)-2A-Puro (Addgene, PX459) was stably transfected into 8×105 DBA/2 ES cells via electroporation ...
-
bioRxiv - Physiology 2023Quote: ... working dilution 1:5) or d-Light1 (pAAV-CAG-dLight1.1, Addgene viral prep # 111067-AAV5 ...
-
bioRxiv - Neuroscience 2022Quote: ... titer: 5 × 1012 GC/ml (Addgene viral prep # 18917-AAV1, RRID:Addgene_18917), and
-
bioRxiv - Biophysics 2022Quote: ... 5 μM Sfp synthase (plasmid obtained from Addgene (pET-Sfp, #159617) and purified as described (Yin et al ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV8-nEF-Con/ Fon-TVA-mCherry (Addgene 131779, 5×1012 titer) and AAV8-EF1α-Con/Fon-oG (Addgene 131778 ...
-
bioRxiv - Neuroscience 2023Quote: ... and AAV8-EF1α-Con/Fon-oG (Addgene 131778, 5×1012 titer) were mixed in equal proportions (final titer = 2.5×1012 each ...
-
bioRxiv - Neuroscience 2023Quote: ... and AAV2/9-pAAV-hDlx-hM4Di-dTomato-Fishell-5 (Addgene, 83896) at a concentration of 6+13 genome copies per ml (gc/ml) ...
-
bioRxiv - Molecular Biology 2024Quote: ... R-5’ CAGACGCGTTTAGCCCTCCCACACATAACCAGA 3’ from pLKO.1-Blasticidin vector (Addgene #26655), and ligated after AgeI and MluI digestion and gel purification with the vector backbones ...
-
bioRxiv - Cancer Biology 2020Quote: ... to co-transfect pBABE-puro or pBABE-puro.SLX4IP.3xFLAG with pCMV-VSV-G (at a ratio of 6:1, Addgene#8454) into GP2-293 cells (Clontech) ...
-
bioRxiv - Molecular Biology 2022Quote: ... in 6-well plates (1.5×106 cells/well) and co-transfected with the cAMP sensor Pink Flamindo (Addgene plasmid #102356) and either empty vector or the given GPR126 construct in the pULTRA vector on the next day using Lipofectamine 2000 according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... U2OS 2-6-3 were transduced with pLenti CMV rtTA3 Blast (w756-1, plasmid #26429; Addgene, gift from E. Campeau) for the expression of rtTA ...
-
bioRxiv - Systems Biology 2020Quote: ... annealed oligonucleotides (Supplementary Table 6) were cloned into a BsaI site of a gRNA expression vector (Addgene Plasmid number 41824) 65 and correct insertion was determined by Sanger sequencing with the SP6 primer (Supplementary Table 6) ...
-
bioRxiv - Neuroscience 2020Quote: ... a series of 6 - 10 microinjections (50 - 100 nL each, 200-300 μm depth) of AAV5.Flex.ArchT.tdTomato (Addgene, #28305-AAV5) were delivered along the posterior to anterior axis of RSC (2.0 to 4.0 mm posterior ...
-
bioRxiv - Bioengineering 2020Quote: ... 400,000 HEK cells were seeded in 6-well plates and the next day transfected with 1 μg psPAX2 (Addgene #12260), 3 μg pCMV-VSV.G (Addgene ...
-
bioRxiv - Cell Biology 2020Quote: The plasmid containing codon-optimized GAL80 sequence driven by a tubulin promoter is a gift from Allison Bardin and corresponds to the combination of pattB-tubP-SV40 - generated by Lee and Luo (Lee and Luo, 1999)-with the codon optimized GAL80 sequence from pBPGAL80Uw-6-a gift from Gerald Rubin (Addgene plasmid #26236 ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were transfected with a 6:1 ratio of a firefly luciferase reporter plasmid driven by a pGL3-RARE-responsive promoter (Addgene) and a Renilla luciferase reporter plasmid driven by a constitutive CMV promoter (Promega) ...
-
bioRxiv - Neuroscience 2022Quote: ... between the age of P60 and P120 (n = 6) were injected with virally encoded Cre-dependent GCaMP in PFC (~300 nl, AAV2/9 flex GCaMP6f, Addgene) and Cre in LEC (140 nl at each site ...
-
bioRxiv - Biochemistry 2021Quote: ... and all described mutants were independently cloned and expressed as a 6× His-SUMO fusion proteins from the expression vector pAL (Addgene). These were cloned utilizing primers in Table S3 ...
-
bioRxiv - Neuroscience 2023Quote: ... The following viruses were injected:: AAV5-hSyn-DIO-hM3Dq-mCherry (DREADD-Gq, titer 6 × 1012 cfu/ml, 250ul bilateral, #44361, Addgene), AAV5-hSyn-DIO-mCherry (control ...
-
bioRxiv - Neuroscience 2022Quote: ... 6 mice from each line were injected bilaterally with a pAAV9-CAG-Flex.GCaMP6s.WPRE.SV40 virus (Addgene, titre ≥ 1×1013 vg/mL) in the medial NAc shell (D1-cre and D2(A2a)-cre mice ...
-
bioRxiv - Biochemistry 2023Quote: ... the C162A mutant and the C162L mutant were independently cloned and expressed as 6× His-SUMO fusion proteins from the expression vector pAL (Addgene). BL21 (DE3 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Lentiviral particles were generated by transfecting HEK 293T cells with 12 μg of pLJM1-mEGFP or pLJM1ALKBH5 plasmids with 6 μg of psPAX2 packaging plasmid and 2 μg of pMD2.G envelope plasmid (Addgene). The medium was replaced 16h after transfection ...
-
bioRxiv - Developmental Biology 2023Quote: ... expressing a dominant negative variant of the rol-6 gene and an empty vector pSK (up to 200 ng μl-1 of DNA) (Addgene) using standard methods (42) ...
-
bioRxiv - Neuroscience 2023Quote: Th-cre rats were randomly assigned to a viral group and infused bilaterally with a cre-dependent AAV encoding either the inhibitory opsin archaerhodopsin T (ArchT; N = 11; 6 males; AAV5-CAG-FLEX-ArchT-tdTomato, Addgene) or a tdTomato fluorescent protein control (tdTomato ...
-
bioRxiv - Neuroscience 2023Quote: ... University of North Carolina Vector Core) or an enhanced yellow fluorescent protein control (eYFP; N = 13, 6 males; pAAV5-Ef1a-DIO-eYFP, Addgene). Virus (0.2 µl ...
-
bioRxiv - Cell Biology 2022Quote: ... we added a signal peptide at the N-terminus of Breg and a 6×His tag at its C-terminus using pHL-sec vector (Addgene)39 ...
-
bioRxiv - Neuroscience 2022Quote: ... and AAV2-hSyn-mCherry (UNC vector core) (Figures 2, 6, & 7; Figure 2 – Figure supplement 1) or retrograde AAV-hSyn-DIO-eGFP (Addgene) and retrograde AAV-hSyn-mCherry (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: For Synaptic plasticity experiments C57Bl/6-Jax mice were injected with AAV-Chronos (pAAV-Syn-Chronos-GFP, Addgene 59170-AAV5) virus in area S2 at locations and concentrations given in Table M2.
-
bioRxiv - Cancer Biology 2024Quote: Two independent sgRNAs (Supplementary Table 6) were designed for each target gene and cloned into lentiCRISPRv2-blast vector (Addgene #83480) or lentiCRISPRv2-puro vector (Addgene #52961 ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were seeded per well of a 6-well plate and co-transfected with 2.8 µg pHAGE-mKeima-LGALS3 (Addgene; 175780), 2.3 µg pPAX2 (Addgene ...
-
bioRxiv - Cell Biology 2024Quote: ... 700,000 HEK293T cells were seeded onto a 6-well plate and 24 hours later transfected with 200 ng pMD2.G (Addgene), 400 ng psPAX2 (Addgene) ...
-
bioRxiv - Immunology 2024Quote: 293T cells were seeded in 6-well plates and transfected with the prISG15-Renilla-hPEST-IRES-Puro construct together with psPAX2 and pMD2.G (Addgene plasmids #12259 and #12260 ...
-
bioRxiv - Neuroscience 2024Quote: ... where a 6-residue histidine tag was inserted at the 587 aa position in the pAAV2-N587X plasmid (Addgene, #130877).
-
bioRxiv - Neuroscience 2024Quote: ... and inserted into sites of GFP in pAAV/L7-6-GFP-WPRE (a gift from Hirokazu Hirai, Addgene plasmid # 126462) (pAAV-L7-6-jGCaMP7f and pAAV-L7-6-jGCaMP7s ...
-
bioRxiv - Neuroscience 2024Quote: ... We re-amplified the rat Slc9a6 cDNA from the TOPO vector and cloned into pAAV-L7-6-GFP-WPRE15 (Addgene, Plasmid #126462 ...
-
bioRxiv - Neuroscience 2024Quote: ... The lentiviral construct for RELN expression was generated by subcloning domains 3–6 (central domains) of RELN from the pCrl construct (Addgene #122443 ...
-
bioRxiv - Genomics 2024Quote: ... 15 million HEK293T cells were transfected 15 million HEK293T cells were grown overnight on 15 cm poly-L-Lysine coated dishes and then transfected with 6 ug pMD2.G (Addgene plasmid # 12259 ...