Labshake search
Citations for Addgene :
501 - 550 of 975 citations for 6 Hydroxymethyl 4 methoxy 5 methyl nicotinic acid methyl ester since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: Guide RNA targeting ATP6V1B2 (5’- AAACTTACCATCATTAGGCA) was cloned into pX330 vector (Addgene, #42230). HCT116 cells were transfected with the guide RNA and single-stranded oligo 5’- tacatgtatacagatttagccacgatatatgaacgcgctgggcgagtggaagggagaaacggctcgattactcaaatccctattctGacAatgcctaatA atggtaagttttggtatttggattataacacacctaatcattttaaagagagagaagacccatctaccttttcgagttgaagttattttgagaacacatc using TransIT-LT (Mirus) ...
-
bioRxiv - Biochemistry 2023Quote: Guide RNA targeting PARP1 (5’- AAACATGTAGCCTGTCTGGA) was cloned into pX330 vector (Addgene, #42230). HCT116 cells were transfected with the guide RNA and single-stranded oligo 5’- tcagtgaacagctgctcctaatttcccatcagaagattctcagctctcccttttccgaccttccagacaggctacatgtttggtaaagggatcta tttcactgatatggtctccaagagtgccaactactgccatacgtctcagggagacccaataggcttaatcctgttgggagaagttgcccttggaaacatgtg agt for A898T mutation and 5’- tggcactcagtgaacagctgctcctaatttcccatcagaagattctcagctctcccttttccgaccttccag acaggctacatgtttggtaaaggaatctgtttcgctgacatggtctccaagagtgccaactactgccatacgtctcagggagacccaataggcttaatc ctgttgggagaagttgcccttggaaacat for Y896C mutation using TransIT-LT (Mirus) ...
-
bioRxiv - Neuroscience 2023Quote: ... mixed at a 5:1 ratio with pCMV(CAT)T7-SB100 (Addgene #34879), and co-transfected to HEK293T cells using TransIT-293 (Mirus) ...
-
bioRxiv - Neuroscience 2023Quote: ... mice were injected with 0.5 µl of AAV2/5-CaMKIIα-GCaMP6f (Addgene, #100834) into the vH (AP -3.28 mm ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 5 μg of VSV-G envelope expressing plasmid pMD2.G (Addgene #12259) were co-transfected into HEK293T cells using calcium phosphate transfection ...
-
bioRxiv - Cancer Biology 2024Quote: ... 500 ng purified oligo were mixed with 5 μg lentiCRISPR v2 (Addgene #52961) backbone ...
-
bioRxiv - Neuroscience 2024Quote: ... For Ca2+ imaging of mPFC layer 5 excitatory neurons 1 μl pAAV.Syn.Flex.GCaMP6s.WPRE.SV40 (Addgene) was injected bilaterally into mPFC of VGlut2-cre mice (+0.9 mm anterior-posterior ...
-
Structures of native SV2A reveal the binding mode for tetanus neurotoxin and anti-epileptic racetamsbioRxiv - Biochemistry 2024Quote: ... Nb1-5 were PCR amplified and subcloned into the vector pBXNPHM365 (Addgene #11099) and fused with a C-terminal (TSII-tagged ...
-
bioRxiv - Neuroscience 2024Quote: ... or AAV2/5-CMV-EGFP (250 nl, Addgene 105530, 2 × 1013 GC / ml), and which has since been published7.
-
bioRxiv - Cancer Biology 2024Quote: ... 5 µg/ml of pT3-EF1a MYC DNA (92046, Addgene, Watertown, MA, USA), and 0.5 µg/ml pCMV HSB2 sleeping beauty transponase was prepared in a sterile 0.9% sodium chloride (NaCl ...
-
bioRxiv - Cancer Biology 2020Quote: ... and pRSV-Rev (at a ratio of 4:1:1:1, Addgene#12259, #12251, #12253)41 into HEK293T cells ...
-
bioRxiv - Neuroscience 2021Quote: ... pAAV5-hSyn-dLigh1.2 (titer ≥ 4×1012 vg/ml) was a gift from Lin Tian (Addgene viral prep #111068-AAV5 ...
-
bioRxiv - Neuroscience 2022Quote: ... (4) P10-3’UTR was amplified from pJFRC81-10XUAS-IVS-Syn21-GFP-p10 (Addgene 36432); (5 ...
-
bioRxiv - Neuroscience 2020Quote: ... DIV 4 neurons were transfected with pGP-CMV-GCaMP6f (a gift from Douglas Kim, Addgene plasmid # 40755 ...
-
bioRxiv - Cancer Biology 2023Quote: SUDHL-4 cell line was infected using pLKO.1-puro-GFP U6 sgRNA (Addgene #50920) containing BAX RNA guides or non-targeting RNA guide:
-
bioRxiv - Molecular Biology 2023Quote: ... 4 x 105 cells from the previous transfection were transfected with pCMV-PEmax (Addgene: 174820)11 (800 ng ...
-
bioRxiv - Cancer Biology 2022Quote: ... sgFIGNL1#4: CCTATACCCAAGCAAGATGG) were cloned into lentiCRISPRv2 (a gift from Feng Zhang, Addgene plasmid #52961) in a single-step digestion-ligation reaction (2 hours (h ...
-
bioRxiv - Neuroscience 2022Quote: [4] DsRed from pBac-DsRed-ORCO_9kbProm-QF2 (a gift from Christopher Potter, Addgene ID #104877) (Riabinina et al. ...
-
bioRxiv - Neuroscience 2024Quote: ... oligonucleotide pairs (Supplemental Table 4) were used for PCR and inserted into pCFD5 (Addgene #73914) via Gibson Assembly ...
-
bioRxiv - Neuroscience 2024Quote: ... oligonucleotide pairs (Sup. Table 4) were used for PCR and inserted into pCFD5 (Addgene #73914)77 via Gibson Assembly.
-
bioRxiv - Cell Biology 2022Quote: ... and pLKO.6 sfCherry were generated from pLKO.1 puro plasmid (Addgene plasmid # 8453; http://n2t.net/addgene:8453; RRID:Addgene_8453; a gift from Bob Weinberg) (Stewart et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... one group of animals (n=6) received a bilateral injection of a virus driving expression of the calcium indicator GCaMP7s (AAV9-hSyn-GCaMP7s-WPRE; Addgene; 300nL per side) targeting the CA1v at the following stereotaxic coordinates ...
-
bioRxiv - Cancer Biology 2021Quote: ... we cloned Myc-FLAG tagged POT1 into T7 expression vector (pcDNA 5/FRT, Addgene) and performed site-directed mutagenesis ...
-
bioRxiv - Cancer Biology 2021Quote: mRFP-FKBP-5-ptase-dom and PM-FRB-CFP plasmids were obtained from Addgene (deposited by the laboratory of T ...
-
bioRxiv - Cell Biology 2020Quote: ... The cell line carrying the 5’TOP element-containing SunTag reporter (Addgene plasmid #119946) together with scFv-GFP and NLS-stdMCP-stdHalo was described previously (Wilbertz et al. ...
-
bioRxiv - Molecular Biology 2021Quote: ... a DNA fragment containing 5′-AGCCATGGGAAACATCGCAC-3′ was cloned into pL-CRISPR.EFS.tRFP (Addgene#57819) (Heckl et al. ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 μl cold lysisg/μl cold lysisl pCAGG>nls-hCas9-nls-GFP (Addgene #99141) and 3 μl cold lysisg/μl cold lysisl U6.3>Lhx5/Sox1/Six3 gRNA f+e was microinjected together with the Fast Green solution (Sigma ...
-
bioRxiv - Genetics 2020Quote: ... Gal4 5’ and 3’ homology arms were PCR-amplified using pDEST-APIGH (Addgene # 112804) as the template ...
-
bioRxiv - Synthetic Biology 2020Quote: ... the sequence of Francisella novicida cas12a was amplified from pUDC175 (Addgene plasmid #103019, (5)) using primers 13553-13554 ...
-
bioRxiv - Cancer Biology 2021Quote: The Rb1 CRISPR plasmid with gRNA sequence 5-GCTCTGGGTCCTCCTCAGGA-3 (TLCV2-RB1, Addgene#87836) was purchased from Addgene ...
-
MEK inhibitor resistance in lung cancer cells associated with addiction to sustained ERK suppressionbioRxiv - Cancer Biology 2022Quote: The sgRNA sequence for RB1 (5’-GCTCTGGGTCCTCCTCAGGA-3’) was cloned into lentiCRISPRv2 (Addgene #52961) plasmid and the co-transfected with psPAX2 (Addgene #12260 ...
-
bioRxiv - Molecular Biology 2020Quote: The hCRIPSRi-v2 library top 5 sgRNAs/ gene (Horlbeck et al. 2016)(Addgene # 83969), was a gift from the Jonathan Weissman lab at UCSF ...
-
bioRxiv - Cell Biology 2022Quote: ... Enhanced GFP (EGFP) was PCR cloned from pLenti CMV GFP Puro (Addgene 658-5) with primers CTCGTCGACCATGGTGAGCAAGGG and CTCGGATCC CGTTACTTGTACAGCTCGT and cloned into hIL8-pCHD at the SalI and BamHI restriction sites.
-
bioRxiv - Molecular Biology 2021Quote: ... laevis b-globin 5′- and 3′-UTR sequences were obtained from pT7TS (Addgene #17091). Mouse Malat1 3′ sequence was obtained from the Comp.25 mutant plasmid (Wilusz et al. ...
-
bioRxiv - Microbiology 2023Quote: ... ATG16L1 shRNA (5’-GTCATCGACCTCCGGACAAAT-3’) was inserted into pLKO.1 puro (Addgene plasmid #8453) to generate pLKO.1-ATG16L1-shRNA ...
-
bioRxiv - Genomics 2023Quote: K562 CRISPRi cells were transduced with the hCRISPRi-v2 top 5 library (Addgene #83969)138 with 840X representation ...
-
bioRxiv - Cancer Biology 2024Quote: ... libraries with 5 sgRNAs per gene (mCRISPRi-v2; the “top5” library from Addgene #1000000092) or 10 sgRNAs per gene (hCRISPRi-v2 ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 x 106 HEK293T cells were co-transfected with 5μg psPAX2 (Addgene, Plasmid # 12260), 5μg pMD2.G (Addgene ...
-
bioRxiv - Cell Biology 2023Quote: ... The FUCCI adenoviral vector was generated by cloning tFucci(CA)5 (Addgene plasmid #153521) into the pShuttle-CMV vector ...
-
bioRxiv - Neuroscience 2023Quote: ... an inhibitory opsin (AAV1-hSyn-SIO-stGtACR2-FusionRed, 5 x 1011 vg/ml, Addgene) or a control virus (AAV2-hSyn-DIO-EGFP ...
-
bioRxiv - Cancer Biology 2023Quote: ... sh2: 5-CCAACAACATCTTCTGCTCC-3’ were cloned into the lentiviral vector pLKO.1 (Addgene #8453)[16] ...
-
bioRxiv - Neuroscience 2024Quote: ... and 1:5 AAV1-Ef1a-fDIO-tdTomato (128434-AAV1, Addgene, 1×10¹³ vg/mL) was made into the craniotomy ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV2/5 (gifted from Melina Fan [Addgene plasmid # 104964; http://n2t.net/addgene:104964; RRID:Addgene_104964]), pAAV2/7 (gifted from James M ...
-
bioRxiv - Immunology 2024Quote: ... Two BA.5 NTD DMS libraries were further assembled into pETcon 2649 vector (Addgene) and electroporated into electrocompetent DH10B cells for plasmid amplification ...
-
bioRxiv - Neuroscience 2024Quote: ... a backbone plasmid of pLV.PARP1#5 (a gift from Didier Trono - Addgene plasmid # 14548), to produce pLV.Usp14shRNA ...
-
bioRxiv - Biophysics 2024Quote: ... 5 μg of pMD2.G envelope plasmid (Addgene #12259, generated in Dr Trono’s lab) and 2.5 μg of pRSV-Rev plasmid (Addgene #12253 ...
-
bioRxiv - Cancer Biology 2024Quote: 10 µg of the expression plasmid and 5 µg pCL-Eco (Addgene plasmid #12371) were co- transfected into Pheonix-Eco cells in the culture medium without antibiotics ...
-
bioRxiv - Microbiology 2020Quote: Lentivirus-derived VLPs were produced by transfecting 10 cm dishes of HEK293T LentiX cells with lentiviral packaging plasmids encoding Gag/Pol (pMDLg/pRRE, 15 µg) and Rev (pRSV-REV, 6 µg) (Addgene plasmids 12251 and 12253) together with vectors expressing SARS-CoV-2 Spike (13 µg ...
-
bioRxiv - Cancer Biology 2022Quote: ... pLenti CMV GFP Hygro (656-4) was a gift from Eric Campeau and Paul Kaufman (Addgene plasmid #17446 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Fibroblasts were reprogrammed by electroporation delivery of episomal vectors pCXLE-hOCT3/4-shp53-F (Addgene, 27077), pCXLE-hSK (Addgene ...