Labshake search
Citations for Addgene :
351 - 400 of 2996 citations for 1 Benzyl 4 5 benzyloxy 6 methoxy 1 indanone 2 ylidenyl methylpiperidine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: pLKO.1 puro (Addgene #8453), pMDLg/pRRE (Addgene #12251) ...
-
bioRxiv - Cell Biology 2024Quote: ... pLKO.1-Scrambled (Addgene #136035) 100 was modified to express H2B-mRuby3 for visual identification of transduced cells based on a nuclear fluorescence signal101 ...
-
bioRxiv - Cancer Biology 2024Quote: ... pLKO.1-TRCN0000020840 (shSTAT3, Addgene), pLKO-TRCN0000280021 (shSTAT1 ...
-
bioRxiv - Plant Biology 2024Quote: ... Acceptors were pOdd1-4 (pCk1-4, Addgene plasmids # 136695-136698) for Level 1 and 3 and pEven1-4 (pCsA-E ...
-
bioRxiv - Cell Biology 2024Quote: ... and 2 (sgRNA-GALC2: 5’ TACGTGCTCGACGACTCCGA 3’) were subcloned individually into pX459 v2.0 (gift from Dr. Feng Zhang, Addgene plasmid #6298832). GALC targeting sequences were further tested by the Off-Spotter software to minimize potential off target effect ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... donor vector (400 ng µl-1) and pHsp70-Cas9 (400 ng µl-1) (Addgene #45945) [69] ...
-
bioRxiv - Neuroscience 2020Quote: ... We then injected the AAV5.CamKII.GCaMP6f.WPRE.SV40 virus (Addgene # 100834; 200 nL at 1 nl.s-1) in hippocampal CA1 using the following coordinates ...
-
bioRxiv - Neuroscience 2022Quote: ... a 1:1 mixture (100 nl total) of either retrograde AAV-hSyn-DIO-eGFP (Addgene) and AAV2-hSyn-mCherry (UNC vector core ...
-
bioRxiv - Neuroscience 2024Quote: ... a 1:1 mixture of AAV8-hSyn-DIO-EGFP (2.3 x 1013 CG/mL, Addgene) and AAV8-Flex-3mts-mScarlet (1.14 x 1013 CG/mL ...
-
bioRxiv - Cell Biology 2020Quote: ... and envelope (6 μg pMD2.G, Addgene #12259) viral plasmids were diluted in 500 μL serum-free DMEM ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 6 μg of psPAX2 (Addgene, Cat #12260) into a 10 cm plate of HEK293T cells at 60-70% using Fugene 6 transfection reagent (Promega ...
-
bioRxiv - Cell Biology 2024Quote: ... the psPax2 packaging plasmid (6 µg, Addgene, #12260), the pMD2.G packaging plasmid (2 µg ...
-
bioRxiv - Bioengineering 2022Quote: ... the modules in these plasmids (split Cas9, MCP, sgRNA cassette) were PCR-amplified and recloned into 2 lentiviral plasmids (pLKO.1 neo, Addgene #13425; pLJM-EGFP, Addgene #19319) and ...
-
bioRxiv - Neuroscience 2023Quote: 750 nl of rAAV.EF1a.DIO.hChR2(H134R).eYFP or rAAV.EF1a.DIO.eYFP (3-4 x 10^12 vg/ml, AAV5, University of North Carolina Vector Core; 1-2 x 10^13 vg/ml, AAV1, Addgene, 27056-AAV1 and 20298-AAV1) were injected into each hemisphere of the VTA of 3–4-month-old DAT-Cre mice ...
-
bioRxiv - Biochemistry 2022Quote: CRISPR-Cas9-mediated gene ablation was carried out using a guide RNA targeting Cmas exon 4 (5’-TGTCGACGAGGCCGTTTCGC-3’) in the plasmid pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene plasmid #42230 from Feng Zhang) as used before.11 TSC were cotransfected with GFP-expressing plasmid peGFP-CI (Clontech ...
-
bioRxiv - Neuroscience 2022Quote: ... then virus (AAV9-CaMKII-Cre, stock 2.1*1013 particles/nL, 1:1 dilution in PBS, Addgene) was pressure injected (NanoJect III ...
-
bioRxiv - Neuroscience 2021Quote: The lentiviral knockdown constructs were made using pLKO.1-Puro or pLKO.1-GFP plasmids (Addgene) (Zhuang et al ...
-
bioRxiv - Neuroscience 2024Quote: ... 3.26e14 GC-ml) diluted 1:1 with PBS or AAV5-CaMKII-GCaMP6f.WPRE.SV40 (Addgene, 2.3e13 GC-ml) diluted with PBS 1:2 into dorsal CA1 (−1.8 mm from Bregma ...
-
bioRxiv - Neuroscience 2024Quote: ... Gq DREADD virus (n=23, 12 males, 11 females: AAV8-hSyn-DIO-hM3Dq-mCherry, ≥ 4×101 2 vg/mL, Addgene; Watertown, MA, USA) was mixed with GAD1-cre to express excitatory designer receptors in VP GABA neurons ...
-
bioRxiv - Cancer Biology 2022Quote: ... and exon 5: AGCCCAAGGATGCCAGCCAG (guide 2) were ordered from IDT (Leuven, Belgium) and cloned into pSpCas9(BB)-2A-GFP(PX458) (Addgene Teddington, UK), according to the protocol of Ann Ran et al ...
-
bioRxiv - Developmental Biology 2023Quote: ... sgRNAs 5’-CCCCATGGACATACCCACTG-3’ and 5’-CCAGTCGAGCAGAAAAGTGT-3’ defining a 244 bp region in Nodal exon 2 were cloned into pX458 (Addgene plasmid #48138) or pX459 (Addgene plasmid #48139 ...
-
bioRxiv - Molecular Biology 2020Quote: ... and residues 1-133 (Addgene #138422) were PCR amplified from pcDNA4/TO-ORF24-3xFLAG (19 ...
-
bioRxiv - Developmental Biology 2021Quote: pLKO.1-puro plasmids (Addgene #8453) were cloned as previously described (78) ...
-
bioRxiv - Cancer Biology 2022Quote: ... pLKO.1 Scrambled shRNA (#1864, Addgene), pLKO.1 HIF2α shRNA (#TRCN0000082307 ...
-
bioRxiv - Cancer Biology 2022Quote: ... pLKO.1-TRC (shSCR) (Addgene; 10879) was used as a control ...
-
bioRxiv - Microbiology 2020Quote: ... and AdEasier-1 cells (Addgene #16399) were a gift from Bert Vogelstein (He et al ...
-
bioRxiv - Biochemistry 2022Quote: ... cloned into pMSCVpuro (Addgene #K1062-1) at Hpa1 and EcoR1 sites to create pMSCVpuro-His-mCherry ...
-
bioRxiv - Developmental Biology 2021Quote: ... U6-1 and U6-3 (Addgene plasmid #83954 ...
-
bioRxiv - Developmental Biology 2020Quote: ... pLKO.1-shSCR (Addgene, Plasmid #1864), was obtained from Addgene (Cambridge ...
-
bioRxiv - Immunology 2023Quote: ... pLKO.1 puro vector (Addgene, #8453) expressing control or Il5ra shRNAs ...
-
bioRxiv - Biochemistry 2023Quote: ... and PSPAX2 (1 μg, Addgene 12,260) in 600 μL per plate OPTIMEM and Lipofectamine 2000 transfection reagent (Invitrogen 11668027 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 1 µg psPAX2 (Addgene 12260) using PEI and following standard protocol.Viral supernatant was harvested after 60 h ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 1 μg psPAX2 (Addgene 12260) using PEI and following standard protocol ...
-
bioRxiv - Biochemistry 2023Quote: ... pLenti-CMV-Hygro (w117-1) (Addgene, 17454 a gift from Eric Campeau & Paul Kaufman) ...
-
bioRxiv - Cell Biology 2024Quote: ... 1 μg pMD2.G (AddGene G12259) and 3 μg psPAX2 (AddGene 12260 ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 μg pCXLE-hSK (Addgene #27078), and 1 μg pCXLE-hOCT3/4-shP53 (Addgene #27077 ...
-
bioRxiv - Molecular Biology 2023Quote: The pLKO.1 (Addgene plasmid #13425) lentiviral vector carrying the neomycin resistance gene was used to express shRNA sequences in targeted cells ...
-
bioRxiv - Microbiology 2022Quote: ... 1 -hygro vector (Addgene, plasmid #24150) was used to generate the pLKO.1-hygro-AMOTL1-sh construct ...
-
bioRxiv - Microbiology 2022Quote: ... psPAX2 (HIV-1 gag/pol) (Addgene) and pMD2.G (encoding VSV-G ...
-
bioRxiv - Cell Biology 2024Quote: ... The pLKO.1 vector (Addgene, 10878) was digested with AgeI-HF (NEB ...
-
bioRxiv - Neuroscience 2024Quote: ... and psPAX2 (1 µg, Addgene #12260), and 20 µl of polyethylenimine (PEI ...
-
bioRxiv - Genomics 2024Quote: ... pLKO.1 puro (#8453 from Addgene). Two different shRNA lentiviral constructs were used for each target gene ...
-
bioRxiv - Neuroscience 2024Quote: ... EGFP-N1 (RRID: Addgene 6085-1). HeLa cells were transfected with 1.5 µg of untagged human Parkin (RRID ...
-
bioRxiv - Genetics 2024Quote: ... 1 µg of Cre (Addgene 12313381) and 1 µg of Flippase (Addgene 1379382 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1 μg psPAX2 (plasmid #12260, Addgene) and 1 μg pVSV-G (plasmid #138479 ...
-
bioRxiv - Bioengineering 2024Quote: ... pCas9-mCherry-Frame +1 (Addgene #66940), and pCRISPaint-mNeon (Addgene #174092 ...
-
bioRxiv - Biochemistry 2020Quote: ... Human ACE2 plasmid was obtained from Addgene (#1786, (6)) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 6 μg of psPAX2 packaging plasmid (Addgene plasmid #12260), and 2 μg pMD2.G envelope plasmid (Addgene plasmid #12259) ...
-
bioRxiv - Neuroscience 2020Quote: ... Animals were infused bilaterally with 1 μl of AAV5-hSyn-DIO-hM4Di-mCherry (1012 particles.ml−1, Addgene, Watertown ...
-
bioRxiv - Cell Biology 2023Quote: ... The aqp1a.1 or aqp8a.1 cDNA was subcloned into pmCherry-N1 or pEGFP-N1 vector (Addgene). Human retinal microvascular endothelial cells (HRMECs ...