Labshake search
Citations for Addgene :
501 - 550 of 2996 citations for 1 Benzyl 4 5 benzyloxy 6 methoxy 1 indanone 2 ylidenyl methylpiperidine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... and 1 µg of pMD2.G (Addgene, 12259) lentivirus packaging plasmids into 8 million HEK293T cells in a 10-cm dish with PolyJet (SignaGen Laboratories ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 1 μg pMD2.G (Addgene plasmid, 12259) combined with the overexpression vectors H2B-cherry ...
-
bioRxiv - Cell Biology 2022Quote: ... together with 1 μg pVSV-G (#138479, Addgene) and 2 μg psPAX2 (#12260 ...
-
bioRxiv - Cell Biology 2022Quote: ... HSV-1 UL12.5 was purchased from Addgene (#70109) and the EGFP was removed by subcloning ...
-
bioRxiv - Immunology 2022Quote: ... then ligated into pLKO.1 vector (Addgene #10878) using AgeI/EcoRI ...
-
bioRxiv - Microbiology 2022Quote: ... and pLVX or pLKO.1 transfer plasmids (Addgene) using jetOPTIMUS according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... we inserted shRNA sequences into pLKO.1 (Addgene) or shmirRNA (Addgene ...
-
bioRxiv - Genetics 2024Quote: ... mixed with 1 μg of PsPax2 (Addgene # 12260), 1 μg of the lentiviral transfer vector G1088E_pLenti-CMV-mNeonGreen-2A-HygroR (Addgene #216279) ...
-
bioRxiv - Cell Biology 2023Quote: ... KIF5C(1-560)-2xmCh-EF(C) (Addgene #61664) and KIF5C(1-560)-mCit (Addgene #61676 ...
-
bioRxiv - Genetics 2023Quote: ... anti-Na/K-ATPase (1:1000, Addgene #180089) (membrane protein loading control) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Lentiviral cloning vector pLKO.1-TRC (Addgene, #10878) was used for shRNA expression ...
-
bioRxiv - Genomics 2023Quote: ... and 1 μg of pMD2.G (Addgene, 12259) packaging plasmids were cotransfected into 8 million HEK293T cells in a 10-cm dish supplemented with 36 μl PolyJet (SignaGen Laboratories ...
-
bioRxiv - Cancer Biology 2023Quote: ... we used human decipher module 1 library (RRID:Addgene_28289)(Diehl et al ...
-
bioRxiv - Cell Biology 2023Quote: ... For lentiviral transfections 1 μg VSVG (Addgene #8454) and 1.86 μg psPAX2 (Addgene #12260 ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV.Ef1a.DIO.EYFP (Addgene #27056-AAV5, 1×1012 vg/ml) was used as a control virus for the optogenetic real time place preference task ...
-
bioRxiv - Cell Biology 2024Quote: ... plKO.1-TetON-Puro-Hif1a 0819 (Addgene 118704).
-
bioRxiv - Cancer Biology 2024Quote: ... pLenti CMV rtTA3 Hygro (w785-1) (Addgene: 26730), pCW57.1-4EBP1_4xAla (Addgene ...
-
bioRxiv - Neuroscience 2024Quote: ... or AAV8.FLEX.tdT (1 × 1013 GC/mL, Addgene viral prep #28306-AAV8 ...
-
bioRxiv - Microbiology 2024Quote: ... into pENTR1A no ccdB (w48-1; Addgene #17398) previously modified to express N-terminal 3x Flag-tagged proteins (96) ...
-
bioRxiv - Immunology 2024Quote: ... and 1 μg of pRSV-Rev (Addgene #12253). 1 d after transfection ...
-
bioRxiv - Cell Biology 2024Quote: ... and the pLKO.1 plasmid (Addgene, Cambridge, MA) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... and 1 µg packaging plasmid psPAX2 (Addgene 12260) using Lipofectamine 2000 ...
-
bioRxiv - Cancer Biology 2024Quote: ... pLV-mCherry-hCdt1(1-100)ΔCy (Addgene #193759), and pCDH-EF1-mVenus-p27K− (Addgene #176651 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 1 μg pVSV-G (plasmid #138479, Addgene) viral packaging plasmids using Lipofectamine 3000 Transfection Reagent (cat ...
-
bioRxiv - Molecular Biology 2023Quote: Constructs for shRNA targeting Primpol (5’- ATTTAGCCGACACCTAATATT) Smarcal1 (5’- CTGATTCAAGAGAAGATTAAA) and Smug1 (5’- AACTATGTGACTCGCTACT) were designed and inserted into pLKO.1neo plasmid (Addgene #13425). Lentiviruses were generated using a standard protocol (Feng and Jasin ...
-
bioRxiv - Cell Biology 2022Quote: ... 6 μg of psPAX2 packaging plasmid (plasmid #12260; Addgene, Teddington, UK), 2 μg pMD2.G envelope plasmid (plasmid #12259 ...
-
bioRxiv - Biophysics 2024Quote: ... and 6 μg of one of the vectors of interest (Addgene #116934 ...
-
bioRxiv - Cell Biology 2024Quote: ... and 6 μg of psPAX2 (Addgene plasmid #12260, from Trono lab). Culture media was changed 12h after transfection ...
-
bioRxiv - Bioengineering 2022Quote: ... with 2 μg MLC-2 plasmid (pEGFP-MRLC1, Addgene, #35680), 10 μg RAR-β siRNA (Santa Cruz ...
-
bioRxiv - Neuroscience 2023Quote: ... virus for optogenetic inhibition or excitation of preBötCOT-R neurons in OT-R::Cre mice was obtained from Addgene (Table 2, Addgene viral prep # 154951 ...
-
bioRxiv - Neuroscience 2023Quote: ... The AAV1-phSyn1(S)-FLEX-tdTomato-T2A-SypEGFP-WPRE virus for tracing experiments from preBötCOT-R neurons to nACardiac neurons in OT-R::Cre mice was obtained from Addgene (Table 2, Addgene viral prep # 51509 ...
-
bioRxiv - Neuroscience 2023Quote: ... The 5-HT1eR and 5-HT1FR PRESTO-Tango constructs were obtained from Addgene. For transfection ...
-
bioRxiv - Neuroscience 2021Quote: ... was mixed 1:1 with the retrogradely trafficked AAV encoding eGFP (AAVrg-hsyn-EGFP, 7.4 × 1012 vg/mL; Addgene, Watertown, MA) and infused into the BLA (AP ...
-
bioRxiv - Neuroscience 2021Quote: 50 nL of AAV1 particles (titer 1 × 1012 cfu mL−1) produced from pAAV-EF1a-double-floxed-hChR2(H134)-EYFP-WPRE-HGHpA (Addgene.org #20298) was injected into L5 of S1 (co-ordinates from bregma ...
-
bioRxiv - Neuroscience 2021Quote: 50 nl of AAV1 particles (titer 1 × 1012 cfu ml−1) produced from pAAV-EF1a-double-floxed-hChR2(H134)-EYFP-WPRE-HGHpA (Addgene #20298) was injected unilaterally into the L5 of S1 (coordinates from bregma ...
-
bioRxiv - Neuroscience 2020Quote: Raphe and RTN neurons - AAV-9: pGP-AAV-syn-GCaMP6s-WPRE.4.641 at a titre of 1×1013 GC·ml- 1 (Addgene, Watertown, MA, USA);
-
bioRxiv - Developmental Biology 2021Quote: ... plasmid was created by Infusion cloning of CMV-GFP(1-10) from pcDNA3.1-GFP(1-10) (a gift from Bo Huang (Addgene plasmid # 70219) into a pUC57 backbone ...
-
bioRxiv - Biophysics 2020Quote: ... 1 µg of HRD plasmid and 1 µg of AAVS1 T2 CRISPR plasmid (a gift from Masato Kanemaki, Addgene plasmid #72833) were transfected into U2OS cells using FuGENE HD (Promega ...
-
bioRxiv - Molecular Biology 2021Quote: ... and YTHDC1 were generated by cloning the shRNA (RNAi Consortium shRNA Library) from pLKO.1-puro into the pLKO.1-blast backbone (Addgene #26655).
-
bioRxiv - Molecular Biology 2020Quote: ... pCGN-ATF6 (1-373) and pCGN-ATF6 (1-373) m1 were gifts from Professor Ron Prywes (Addgene plasmid 11974, 27173, 27174).
-
bioRxiv - Cell Biology 2022Quote: ... pBa-Kif1A(1-396)-tdTomato-FKBP was generated by Asc1/Hpa1 restriction digest of pBa.Kif1a 1-396.GFP (backbone; Addgene, Cat #45058) and of pBa-KIF5C 559-tdTomato-FKBP (insert ...
-
bioRxiv - Cell Biology 2020Quote: ... pDEST-swiprosin-1-V2 was generated by performing a clonase reaction between pCR8GWTopo-swiprosin-1 and pDEST-ORF-V2 (Addgene 73638). pEF.DEST51-mVenus was obtained from Addgene (plasmid #154899).
-
bioRxiv - Neuroscience 2020Quote: pFL - AAV-9: pGP-AAV-syn-GCaMP6f-WPRE.24.693 at a titre of 1×1013 GC·ml-1 (Addgene, Watertown, MA, USA).
-
bioRxiv - Evolutionary Biology 2021Quote: ... The two pools were then combined at a 1:1 ratio and cloned into a doubled digested (AgeI/SbfI) pLS-SceI vector (Addgene, 137725) with NEBuilder HiFi Master Mix (NEB) ...
-
bioRxiv - Biochemistry 2022Quote: An insert of ZZUD and ZZUDL1340P were cloned out from a positive pGEX-6P-1-ZZUD or pGEX-6P-1 - ZZUDL1340P with PCR based cloning procedure into a pEGFP-C1 (Addgene 54759) or mRFP-C1 (Addgene 54764 ...
-
bioRxiv - Cell Biology 2022Quote: RPE-1.iPLK4 and RPE-1.iPLK41-608 cell lines were generated using pLenti-CMV-TetR-Blast lentiviral vector (Addgene, 17492) and selected using Blasticidin (10 µg/mL) ...
-
bioRxiv - Molecular Biology 2023Quote: ... were individually cloned into pRSFDuet-1 using the BamHI and HindIII restriction enzyme sites to generate pRSFDuet-1 IntS6 AA 1035-1284 (Addgene #196904) and pRSFDuet-1 IntS8 AA 1-308 (Addgene #196905) ...
-
bioRxiv - Molecular Biology 2023Quote: ... was cloned into pRSFDuet-1 using the SalI and HindIII restriction enzyme sites to generate pRSFDuet-1 IntS11 AA 300-597 (Addgene #199329). Details of cloning ...
-
bioRxiv - Neuroscience 2022Quote: ... mice (see Table 1) were injected with pAAV9-EF1a-DIO-ChrimsonR-mRuby2-KV2.1-WPRE-8V40 (Addgene, titer: 1×1013 vg/mL) or ssAAV-9/2-hEF1a-dlox-eNpHR3.0_iRFP(rev)-dlox-WPRE-hGHp(A ...
-
bioRxiv - Neuroscience 2023Quote: ... We injected 50-100 nL of AAV (AAV2/1-Syn-jGCaMP8m-WPRE, Addgene #162375 or AAV2/1-Syn--GCaMP6s-WPRE-SV40, Addgene #100843) either in the AC in two locations (Coordinates ...