Labshake search
Citations for Addgene :
3701 - 3750 of 3780 citations for 6 9 Ethano 4H imidazo 4 5 d pyridazino 1 2 a pyridazin 4 one 2 butyl 3 6 7 8 9 11 hexahydro 6 9 dimethyl 3 2' 2H tetrazol 5 yl 1 1' biphenyl 4 yl methyl since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2021Quote: ... HEK293FT cells were transfected with one of the three destination vectors plus a lentiviral packaging vector (psPAX2, Addgene plasmid #12260) and a VSV-G envelope expressing vector (pMD2.G ...
-
bioRxiv - Microbiology 2021Quote: The SpCas9 and guide RNA (gRNA) CRISPR components were both expressed from the one-vector lentiviral system “lentiCRISPR_v2” {25075903} (Addgene #52961). gRNA sequences for target genes were designed by submitting the sequence of an early exon (common to all isoforms ...
-
bioRxiv - Genomics 2021Quote: ... one set of cells received a lentivirus expressing the Cre recombinase under the control of the hSyn1 promoter (Addgene 86641). This induced expression of the dCas9p300 transgene in the neurons ...
-
bioRxiv - Biochemistry 2024Quote: ... Step one assembly reactions were set up to obtain the vectors pACEBac1-POMP-PAC1-PAC2-PAC3-PAC4 (Addgene plasmid #XXXX), pACEBac1-PSMA1-PSMA2-PSMA3-PSMA4 ...
-
bioRxiv - Bioengineering 2023Quote: ... Each well was transfected with 7.5 μg of one sgRNA plasmid of interest and 7.5 μg of a SpCas9 encoding plasmid (AddGene plasmid# 48137) through the calcium phosphate precipitation method as previously described (31) ...
-
bioRxiv - Genetics 2023Quote: ... in an all-in-one tetracycline- inducible expression cassette with AAVS1 homology arms (AAVS1-TRE3G-EGFP was a gift from Su-Chun Zhang (Addgene plasmid # 52343 ...
-
bioRxiv - Cancer Biology 2023Quote: ... which were designed by the Zhang lab to specifically target APOBEC3B53 were first subcloned into the all-in-one lentiCRISPR v2 plasmid (Addgene plasmid # 52961- a gift from Feng Zhang)53 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... we used one of our previously established plasmids that harbors the wild-type hTdT gene in a pcDNA3.1 backbone (Addgene #126450)36 ...
-
bioRxiv - Molecular Biology 2024Quote: ... The base editing vectors were all-in-one cytosine or adenine base editor + guide expression constructs (Addgene, #158581 and #179097). The gRNA screening vector was a modified CROP-seq vector (Addgene ...
-
bioRxiv - Bioengineering 2023Quote: ... the neurons were transduced with 1 µL of an adeno-associated virus serotype 9 (AAV9) carrying a fluorescent calcium ion indicator GCaMP6s under a pan-neuronal human synapsin (hSyn) promoter (AAV9-hSyn::GCaMP6s, Addgene viral prep #100843-AAV9, >1×1013 IU/µL). After 5 days of incubation ...
-
bioRxiv - Neuroscience 2020Quote: ... Chronos was manufactured at the University of Pennsylvania Vector Core (AAV2/8.Syn.Chronos.tdTomato, Addgene 62726, 1.6×1013 GC/ml). oChIEF was manufactured by Virovek (AAV2/1.CAG.flex.oChIEF.tdTomato ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Optimal magnesium concentration was determined to be 8 mM based on expression of the plasmid pJL1-sfGFP (Addgene #69496) encoding superfolder Green Fluorescent Protein (sfGFP).
-
bioRxiv - Neuroscience 2024Quote: ... and 8 rats were bilaterally injected with AAV5-CaMKIIα-mCherry control virus (titer, 2.3×1013; Addgene http://addgene.org/114469).
-
bioRxiv - Neuroscience 2024Quote: ... 8 rats were bilaterally injected with DREADDs virus AAV5-CaMKIIα-hM4Di-mCherry (titer, 2.3×1013; Addgene http://addgene.org/50477) and 8 rats were bilaterally injected with AAV5-CaMKIIα-mCherry control virus (titer ...
-
bioRxiv - Bioengineering 2019Quote: ... Neurons were dissociated and seeded on 4 different MEAs at ~3000 cells/mm2 over the electrode area and cultured in NbActiv1™ medium for at least 7-14 days prior to transfection with Fubi-ChR2-GFP (Addgene plasmid # 22051) or 21 days prior to transfection with C1V1tt (Addgene plasmid # 35497) ...
-
bioRxiv - Neuroscience 2024Quote: ... and a bilateral infusion of either AAV2.CMV::nNOS-shRNA-EGFP or AAV2.CMV::luciferase-shRNA-EGFP combined with an AAV2.hsyn::DIO-mCherry (Addgene, titer: ∼7×1012) into the NAcore ...
-
bioRxiv - Cell Biology 2022Quote: ... Tau fragments were subcloned into pcDNA3.1 by restriction digestion and further into pCW57.1- MAT2A all-in-one tet-off lentiviral backbone (a gift from David Sabatini (Addgene plasmid # 100521))71 by Gibson assembly ...
-
bioRxiv - Molecular Biology 2022Quote: U-2 OS CRISPR knockout lines were generated using the All-in-One plasmid encoding dual sgRNAs and fluorescent protein-coupled Cas9D10A nickase (AIO-GFP; Addgene #74119) (Chiang et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... sgRNAs were synthesized and subcloned into the BsmBI site of the all-in-one (dox-inducible Cas9-2A-eGFP and constitutive U6 promoter) TLCV2 vector (Addgene #87360). sAC-targeted sgRNAs ...
-
bioRxiv - Cancer Biology 2022Quote: ... and DNMT3B shRNAs were cloned into Tet-ON all- in-one plasmids LT3GEPIR (gift from Johannes Zuber, Addgene Plasmid #111177, RRID:Addgene_111177) and LT3REPIR (same as LT3GEPIR except for GFP being substituted with dsRed ...
-
bioRxiv - Physiology 2020Quote: ... Mice were injected in each side or one side of the DMH with ∼0.5 µL AAV2-hSyn-DIO-hM3D(Gq)-mCherry (Addgene, Cambridge, USA), AAV2-hSyn-DIO-hM4D(Gi)-mCherry (Addgene) ...
-
bioRxiv - Genetics 2020Quote: ... All-in-one-plasmids encoding both Cas9 and the desired sgRNA were created by site-directed mutagenesis of pDD162 (Addgene #47549) (Dickinson et al ...
-
bioRxiv - Cell Biology 2022Quote: ... the same procedure was conducted to create and quantify the one-vector format Brunello human CRISPR knockout pooled library (Addgene #73179,59).
-
bioRxiv - Microbiology 2022Quote: ... insertion of was performed by ClonExpress II One Step Cloning Kit (Vazyme, China) with SpeI-digested pENTR4-FnCas12a and TetR amplicon of plasmid pFREE vector (Addgene, #92050) with the primer pair Tet-F3/Tet-R3 ...
-
bioRxiv - Neuroscience 2024Quote: ... Pulled injection pipettes were beveled and back-filled with mineral oil before being loaded with one or more of the following: AAV1-Syn-ChrimsonR-tdTomato (Chrimson, 2.10e+13 gc/mL, 250 nL, Addgene #59171-AAV1), AAV5-Syn-FLEX-rc [ChrimsonR-tdTomato] (FLEX-Chrimson ...
-
bioRxiv - Developmental Biology 2022Quote: ... guide RNA targeting the first exon of the mouse NHE1 gene was designed and cloned into an all-in-one doxycycline (Dox)-inducible vector TLCV2 (Addgene #87360). In brief ...
-
bioRxiv - Neuroscience 2023Quote: The all-in-one gRNA-Cas9 expression plasmid used for CRISPRa was generated by modifying the hUBC-dSpCas9-2xVP64-T2A-BSD plasmid (Addgene #162333) to remove the T2A-BSD selection marker and include a U6-gRNA scaffold ...
-
bioRxiv - Cell Biology 2023Quote: ... Each of the following plasmids (15 µg) was added to one 15-cm dish: ASCL1 (TetO-ASCL1-puro, Addgene plasmid # 97329), DXL2 (TetO-DXL2-hygro ...
-
bioRxiv - Cell Biology 2021Quote: ... 0.75 μg of psPAX2 and 0.25 μg of pMDL.g (gifts from D. Trono, Addgene #12260, #12259). At 36 hours post transfection ...
-
bioRxiv - Genetics 2022Quote: ... The plasmid encoding the sgRNA n°8 used in this study is available on Addgene (BPK1520-sgRNA GLB1, Addgene #184378).
-
bioRxiv - Systems Biology 2019Quote: ... the cells were transfected with a mix of 8 µg lentiviral lentiCRISPRv2 vector containing the TKOv3 gRNA library (Addgene #90294) (Hart et al ...
-
bioRxiv - Pathology 2021Quote: ... of adeno-associated virus serotype 8 encoding Cre recombinase under the hepatocyte-specific thyroid binding globulin promoter (AAV8-TBG-Cre) (Addgene) followed by a 12 days (12d ...
-
bioRxiv - Biochemistry 2024Quote: ... AriB or AriA-AriB were cloned into an arabi-nose-inducible UC Macrolab vector 8-B (Addgene #37502; ampicillin-resistant) and Ocr was cloned into an IPTG-inducible pTrc99A-based vector (kanamycin-resistant) ...
-
bioRxiv - Neuroscience 2023Quote: ... DAT-Cre+/- / SERT-Flp+/- mice were injected with 500 nL of either AAV-DJ-ef1a-DIO-ChR2-eYFP or AAV-DJ-ef1a-DIO-eYFP bilaterally into the VTA and 1000 nL of AAV-8-nEF-CoffFon-NpHR3.3-eYFP (Addgene #137154) or AAV-DJ-ef1a-fDIO-eYFP into the DR and implanted bilaterally with optical fibers in the NAc medSh ...
-
bioRxiv - Cell Biology 2022Quote: ... The sgRNA expression vectors were generated by cloning appropriate DNA oligonucleotides (Suppl. Table 8) in the BbsI restriction sites of pX459 (#62988, Addgene). In brief ...
-
bioRxiv - Neuroscience 2023Quote: AAV serotype 8 viral vectors encoding for floxed EGFP under the synapsin promoter (pAAV-hSyn-DIO-EGFP (#50457)) were purchased from Addgene. rAAV-PV-EGFP-bGH polyA and rAAV-PV-CRE-EGFP-bGH polyA encoding for EGFP under the PV promoter were purchased from BrainVTA ...
-
bioRxiv - Neuroscience 2024Quote: ... and then bilaterally injected with 150 nl of rgAAV-hSyn-DIO-hM3Gq-mCherry (∼8 x 1012 GC/mL, cat. #: 44361-AAVrg, Addgene) in the suprachiasmatic nucleus (SCN ...
-
bioRxiv - Cell Biology 2021Quote: Plasmid pT7-7 α-Syn A53T for the expression and purification of recombinant α-Syn was a gift from Hilal Lashuel (Addgene plasmid #10572784) and EGFP-α-SynA53T plasmid for α-Syn expression in HEK293T and SH-SY5Y cells was a gift from David Rubinsztein (Addgene plasmid #4082385)).
-
bioRxiv - Genetics 2019Quote: We cloned Lamin A or Lamin C cDNAs with S22 and S392 mutations or without mutations into the all-in-one doxycycline inducible lentivirus vector pCW57-MCS1-P2A-MCS2-PGK-Blast (gift from Adam Karpf; Addgene plasmid #80921) (Barger et al. ...
-
bioRxiv - Synthetic Biology 2019Quote: ... All other sgRNAs were cloned into plasmid pEJS654 All-in-One AAV-sgRNA-hNmeCas9 (kind gift from Erik Sontheimer, Addgene plasmid #112139) via the SapI restriction sites ...
-
bioRxiv - Cell Biology 2022Quote: ... plasmid (TLCV2-ApaLI(*)-T2A-mTagBFP2-Puro) used in all other figures were cloned using the all-in-one Dox-inducible lentiviral backbone of TLCV2 (Addgene Plasmid #97360) by inserting mito-ApaLI(* ...
-
bioRxiv - Biochemistry 2023Quote: ... fluorophore labelled ‘601’ DNA was generated using large-scale PCR with Phusion polymerase (produced in-house) from a pGEM- 3z/601 plasmid containing one copy of ‘601’ DNA (gift from J. Widom, Addgene plasmid #26656)(Lowary & Widom ...
-
bioRxiv - Neuroscience 2023Quote: ... 76 and CaVα2δ1 (p752; CaVα2δ1 was a gift from D. Lipscombe, Addgene plasmid # 26575; http://n2t.net/addgene:26575; RRID: Addgene_26575) 77 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 0.75 μg of psPAX2 and 0.25 μg of pMD2.g (gifts from D. Trono, Addgene #12260, #12259). At 36 hrs post transfection ...
-
bioRxiv - Cancer Biology 2019Quote: ... sequence (5’-TGAAAGCCACCAGACCTCGA) targeting exon 8 of the murine leptin receptor (LepR) was ligated into the BsmBI site in lentiGuide-Puro (Addgene 52963) with compatible annealed oligos to generate lentiGuide-Puro-sgLepR ...
-
bioRxiv - Neuroscience 2021Quote: ... 8-12 weeks old Ucn3::Cre male mice were stereotaxically injected with pAAV-hSyn-DIO-hM3D(Gq)-mCherry (Addgene, Cambridge, MA) bilaterally into the PeFA (AP −0.6 ...
-
bioRxiv - Systems Biology 2020Quote: ... the cells were transfected with a mix of 8 μg lentiviral lentiCRISPRv2 vector containing the TKOv3 gRNA library 21 (Addgene #90294), 4.8 μg packaging vector psPAX2 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and to the cell suspension was also added 8 ug of donor plasmid (AICSDP-52: HIST1H2BJ-mEGFP is Addgene plasmid # 109121). Cells were then electroporated using a Gene Pulser Xcell electroporation system at 160 V for 30 ms ...
-
bioRxiv - Cancer Biology 2023Quote: ... sgRNA vectors for each given condition (OE, KO, NT) were pooled and co-transfected with pAdH helper plasmid and pAAV2/8 capsid (Addgene, #112864) with polyethylenimine (PEI) ...
-
bioRxiv - Cell Biology 2024Quote: sgRNA sequences targeting Atg7 (CACCGTCTCCTACTCCAATCCCGTG), Pcyt2, (CACCGCCATGATCCGGAACGGGCA) or a non-genic region on mouse chromosome 8 (Chr8, ACATTTCTTTCCCCACTGG) were cloned into lentiCRISPRv2 (Addgene, 52961). sgRNA sequences targeting Trp53 (GAAGTCACAGCACATGACGG ...