Labshake search
Citations for Addgene :
3601 - 3650 of 3780 citations for 6 9 Ethano 4H imidazo 4 5 d pyridazino 1 2 a pyridazin 4 one 2 butyl 3 6 7 8 9 11 hexahydro 6 9 dimethyl 3 2' 2H tetrazol 5 yl 1 1' biphenyl 4 yl methyl since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... mEmerald-Lifeact-7 was a gift from Michael Davidson (Addgene plasmid # 54148 ; http://n2t.net/addgene:54148 ; RRID:Addgene 54148) For protein depletion ...
-
bioRxiv - Cell Biology 2022Quote: ... The plasmids used in this study were as follows: YFP-Mito-7 was a gift from Michael Davidson (Addgene plasmid # 56596 ; http://n2t.net/addgene:56596 ; RRID:Addgene_56596), EGFP-DCX was a gift from Joseph Gleeson (Addgene plasmid # 32852 ...
-
bioRxiv - Neuroscience 2023Quote: ... The CMV::tdTomato-Lifeact-7 plasmid (abbreviated Lifeact throughout the manuscript) was a gift from Michael Davidson (Addgene plasmid # 54528 ...
-
bioRxiv - Molecular Biology 2022Quote: ... using primer 1008F and 1007R and cloning it into AgeI and FseI sites of pLdCH (Addgene #84291, (7)) ...
-
bioRxiv - Biophysics 2023Quote: ... The pT7-7 aSyn C141 plasmid was a gift from Gabriele Kaminski Schierle (Addgene plasmid #108866; RRID: Addgene_108866). After lysis with boiling ...
-
bioRxiv - Neuroscience 2023Quote: ... mKeima-Red-Mito-7 was a gift from Michael Davidson (Addgene plasmid # 56018; http://n2t.net/addgene:56018; RRID:Addgene_56018) Transfections have been performed with Lipofectamin 3000 (Thermofisher ...
-
bioRxiv - Biophysics 2023Quote: ... The pT7-7 aSyn C141 plasmid was a gift from Gabriele Kaminski Schierle (Addgene plasmid #108866; RRID: Addgene_108866). After lysis with boiling ...
-
bioRxiv - Developmental Biology 2023Quote: ... TdTomato-LifeAct tdTomato-Lifeact-7 was a gift from Michael Davidson (Addgene plasmid # 54528 ; http://n2t.net/addgene:54528 ; RRID:Addgene_54528). Primers for all subcloned constructs are shown in Supplementary Table 8 ...
-
bioRxiv - Biochemistry 2023Quote: The pT7-7 α-syn WT plasmid (a gift from Hilal Lashuel, Addgene, Watertown, NY, United States (61)) ...
-
bioRxiv - Cell Biology 2023Quote: ... donor constructs were: AICSDP-8:TOMM20-mEGFP (Addgene plasmid #87423; http://n2t.net/addgene:87423; RRID:Addgene_87423), AICSDP-13:FBL-mEGFP (Addgene plasmid #87427 ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV2/8 (gifted from James M. Wilson [Addgene plasmid # 112864; http://n2t.net/addgene:112864; RRID:Addgene_112864]) and pAAV2/AAVrh10 (gifted from James M ...
-
bioRxiv - Physiology 2021Quote: ... and/or mCherry-HSP90 (provided by D. Picard, Addgene plasmid #108223; RRID:Addgene_108223). Cells were cultured in Ham’s F12K media (ThermoFisher Scientific ...
-
bioRxiv - Physiology 2021Quote: ... and/or mCherry-HSP90 (provided by D. Picard, Addgene plasmid #108223; RRID:Addgene_108223). Cells were cultured in Ham’s F12K media (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: An HBV genotype D subtype ayw replicon (62) was obtained from Addgene. HBV Ae (genotype A) ...
-
bioRxiv - Neuroscience 2023Quote: ... 76 and CaVα2δ1 (p752; CaVα2δ1 was a gift from D. Lipscombe, Addgene plasmid # 26575 ...
-
bioRxiv - Cell Biology 2023Quote: ... and 0.7 µg pMD2.G (a gift from D. Trono, Addgene #12259), mixed with 9 µL lipofectamine 2000 transfection reagent in 2 mL Opti-MEM-I medium ...
-
bioRxiv - Microbiology 2023Quote: ... respectively and cloned into the pLenti6/V5-D-TOPO backbone (Addgene, #22945). The mouse Cul1 and Ube2l3 coding sequences were amplified from cDNA prepared from NiMOE cells and cloned into the pLenti6/V5-D-TOPO backbone (Addgene ...
-
bioRxiv - Cell Biology 2019Quote: ... HEK293T cells were co-transfected using lentiviral packaging plasmids (psPAX2 and pMD2.G) with a PLKO.1-blast plasmid (Addgene, Cambridge, MA, USA, #26655) containing shSmad2 or shYAP ...
-
bioRxiv - Cancer Biology 2019Quote: ... H2B-RFP in pENTR1A (w507-1) and pENTR1A-GFP-N2 (FR1) were gifts from Eric Campeau and Paul Kaufman (Addgene plasmids # 22525 and # 19364). H2B-GFP plasmids were transduced using lentivirus infections.
-
bioRxiv - Cancer Biology 2022Quote: For CRISPR/Cas9 knockout AMPK sgRNA plasmids targeting exon 1 of AMPK α1 and αβ (pX462-hPRKAA1-gRNA, pX462-hPRKAA2-gRNA, #74374-74377) were purchased from Addgene (Watertown, MA, USA). LNT-229 ...
-
bioRxiv - Neuroscience 2022Quote: ... To chemogenetically activate PVNOT neurons by means of DREADD we employed AAV2/1-DIO-hSYN1-hM3Dq-mCherry (Addgene # 44361; titer: 1.6 × 1013 gc/ml) versus a respective control virus AAV2/1-DIO-hSYN1-mCherry (Addgene # 50459 ...
-
bioRxiv - Developmental Biology 2024Quote: In-frame integration of Dendra2 into the C-terminus of apoBb.1 was achieved using TALENs as previously described and validated (56) (Addgene stock 128695 and 128696). TALENs were in vitro transcribed using the T3 Message Machine Kit (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2019Quote: ... Lamin A-mEmerald (mEmerald-LaminA-N-18) and NLS-mCherry (mCherry-Nucleus-7) were gifts from Michael Davidson (Addgene plasmids #54139 and #55110 ...
-
bioRxiv - Biophysics 2022Quote: ... The plasmid MApple-LC-Myosin-N-7 was a gift from Michael Davidson (Addgene plasmid 54920; http://n2t.net/addgene : 54920; RRID : Addgene_54920). The plasmid MCherry-Actin-C-18 was a gift from Michael Davidson (Addgene plasmid 54967 ...
-
bioRxiv - Neuroscience 2021Quote: ... over V1 using an ultrafine dental drill and inserted a glass pipette backfilled with AAV2.1-EF1a-double floxed-hChR2(H134R)-EYFP-WPRE-HGHpA (titer: 7×1012 vg/mL, 20298-AAV1 Addgene). In total 50 nL was injected in V1 (bilateral binocular V1 for Task A and unilateral V1 for Task B ...
-
bioRxiv - Neuroscience 2022Quote: ... or AAVrg-hSyn-DIO-hM3D(Gq)-mCherry (titer >7×1012 vg/ml, viral prep #44361-AAVrg, Addgene, US,68). For canine adenovirus (CAV ...
-
bioRxiv - Biophysics 2019Quote: ... This α-actinin1-SNAP-His fragment was introduced downstream of the T7 promoter of pET T7-7 plasmid (Addgene).
-
bioRxiv - Biochemistry 2021Quote: The guide RNA sequence CAGAATTGGCGCTATGCTAC targeting exon 7 of FUT8 was cloned into px458 pSpCas9(BB)-2A-GFP (Addgene). The resulting plasmid was transfected into Huh7 cells using ViaFect (Promega ...
-
bioRxiv - Neuroscience 2021Quote: ... AAVrg-CAG-GFP (titer ≥ 7×1012vg/mL, category number 37825, lot V9234) was purchased from Addgene (Watertown, MA, USA).
-
bioRxiv - Bioengineering 2022Quote: ... To generate H2B-iRFP lentiviral particles HEK 293T cells were plated in a 6-well plate (7×105 cells per well) and transiently transfected with 1.5 μg of pLenti-pGK-DEST-H2B-iRFP vector (Addgene # 90237 ...
-
bioRxiv - Developmental Biology 2023Quote: Full length fmi cDNA from UAS-fmi (ref 7) was subcloned in two EcoR1-Xho1fragments into pQUAST (#24349; Addgene) and transformed into w1118 flies to generate random genomic insertions.
-
bioRxiv - Cell Biology 2022Quote: ... The plasmids used in this study were as follows: YFP-Mito-7 was a gift from Michael Davidson (Addgene plasmid # 56596 ...
-
bioRxiv - Neuroscience 2023Quote: Adult mice were stereotaxically injected at 7-10 weeks of age with 600 nl of 1.5×1013 vg/ml AAV1-CKIIa-stGtACR2-FusionRed (AddGene) or 7×1012 vg/ml AAV1-CKIIa-mCherry control at bilateral ACC (antero-posterior (AP ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... experimental animals received bilateral infusions (0.5 µL/hemisphere) of AAV5-hSyn-DIO-hM3D(Gq)-mCherry (7×1012 vg/mL; Addgene) into the VTA as described in [32] ...
-
bioRxiv - Neuroscience 2024Quote: ... Each eye was injected with 1μL of AAV2-Ef1a-fDIO-mCherry (7×10¹² vg/mL; Addgene, Catalog #: 114471-AAV2) using a custom Hamilton syringe (Borghuis Instruments ...
-
bioRxiv - Cancer Biology 2024Quote: ... All sgRNAs used for validation (Supplementary Table 7) were cloned into the pLenti-sgRNA(lib)-puro vector (Addgene, #119976) through Golden Gate assembly ...
-
bioRxiv - Neuroscience 2024Quote: 120 000 iPS cells were plated on 12-well plates one day before the transduction by lentiviruses pLV_TRET_hNgn2_UBC_Puro (Addgene: 61474) and pLV_hEF1a-rtTA3 (Addgene:61472 ...
-
bioRxiv - Neuroscience 2023Quote: ... Control mice were injected with one of two control viruses: AAV9-hSyn-DIO-mCherry (AddGene Plasmid #50459), virus titer 2.17 x 1013 or AAV9-hSyn.HI.eGFP-Cre-WPRE-SV40 ...
-
bioRxiv - Microbiology 2022Quote: Transfection of 24ST1NLESG cells was carried out with 8 μg PAK1 expression plasmid (Addgene, cat # 12208), PAK2 expression plasmid (Sino Biologicals ...
-
bioRxiv - Biochemistry 2023Quote: ... with the only difference being the use of the pAAV2/8 packing plasmid (Addgene Plasmid #112864) for serotyping ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... mice were injected with AAV2/8-CaMKII-hM4D(Gi)-mCherry (Addgene, titer: 2.3*1013 genome/mL) or AAV2/5-CaMKII-mCherry (UNC Vector Core ...
-
bioRxiv - Developmental Biology 2023Quote: ... pCS2+8 was a gift from Amro Hamdoun (Addgene plasmid #34931; http://n2t.net/addgene:34931; RRID:Addgene_34931) (Gokirmak et al. ...
-
bioRxiv - Synthetic Biology 2019Quote: ... Sequence maps are included in File S2 and plasmids useful for constructing additional two-gene expression systems (pJS101 and pJS102, Table 1) are available from AddGene (deposit numbers 118280 and 118281) and have been verified by whole-plasmid sequencing [33].
-
bioRxiv - Cancer Biology 2021Quote: ... plus pSPAX2 and pMD2.G (gifts from D. Trono; Addgene #12260 and #12259) using Lipofectamine 2000 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and pseudo typed with pMD2.G (gift of D. Trono; Addgene plasmid #12259). Following transfection ...
-
bioRxiv - Neuroscience 2024Quote: ... sechellia UAS-SPARC2-D-CsChrimson: we digested a SPARC2-backbone vector (Addgene #133562) with SalI and inserted a CsChrimson-Venus cassette after PCR amplification from pBac(UAS-ChR2 CsChrimson,3xP3::dsRed ...
-
bioRxiv - Cell Biology 2020Quote: Plasmids for the expression of recombinant α-Syn were: pT7-7 α-Syn (Addgene plasmid #3604636; http://n2t.net/addgene:36046; RRID:Addgene_36046) and pT7-7 α-Syn A53T (Addgene plasmid #10572737 ...
-
bioRxiv - Neuroscience 2021Quote: ... 1 µL of 4.6 x 1012vg/mL AAV5-hSyn-DIO-hM4D(Gi)-mCherry (UNC Viral Vector Core; (Krashes et al., 2011)) or 7 x 1012vg/mL AAV5-hSyn-DIO-mCherry (Addgene) was injected at 2.1 mm below the surface of the brain (Andrews-Zwilling et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... CRF1-cre mice were injected with 500 nL/hemisphere of AAV5-hSyn-DIO-eGFP (50457-AAV5; titer ≥ 7×10¹² vg/mL, Addgene) into the VTA (ML ±0.60 ...
-
bioRxiv - Neuroscience 2024Quote: ... animals were injected bilaterally in the mPFC with an anterograde Cre-dependent AAV5-hSyn-DOI-hM3Dq-mCherry (7×10¹² vg/mL, plasmid #44361, Addgene) for RHA rats (hM3Dq-group ...