Labshake search
Citations for Addgene :
301 - 350 of 736 citations for tert Butyl 10 oxo 4 9 diazaspiro 4.5 decane 4 carboxylate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... and transfected at 4-6 h with a plasmid encoding HA-Separase (pCS2+HA-hSeparase was a gift from Marc Kirschner, Addgene plasmid # 33018), Plk1TD expression was induced 8-10 h after shake off and cells were fixed at 28 h to analyze distancing or at 32 h (20 h of S phase arrest ...
-
bioRxiv - Cell Biology 2021Quote: ... Raji or SKW6.4) were infected with Cas9 expressing viruses that were produced in HEK293T cells transfected with the lentiCas9-Blast (#849, Addgene plasmid #52962), pMD2.G ...
-
bioRxiv - Neuroscience 2020Quote: 8 weeks old Mrap2fl/fl Mc4regfp females (n=4) were injected unilaterally with pAAV-Ef1a-mCherry-IRES-CRE (Addgene, catalog #55632-AAV8).
-
bioRxiv - Developmental Biology 2023Quote: Riboprobes for in situ hybridization were synthesized using the oligonucleotide primers listed in Supplementary Table 4 to clone the DNA fragment of interest into vector pJC53.2 (Addgene Plasmid ID: 26536), followed by riboprobe synthesis previously described 80.
-
bioRxiv - Genomics 2023Quote: ... 16 ug of plasmid were prepared for each plate at a ratio of 4:3:1 (sgRNA library: psPAX2(Addgene ID 12259): pMD2G(Addgene ID 12260)) ...
-
bioRxiv - Cell Biology 2024Quote: ... The fragment encoding the Cerulean gene containing 3xNLS was amplified from the template pCerulean-PCNA-19-SV40NLS-4 (a gift from Michael Davidson; Addgene plasmid # 55437) using primer pair 6380 (5’- GGA GCC TCA GCC GCT TCA GCT GCT CCG GTC GCC ACC ATG GTG AG -3’ ...
-
bioRxiv - Genetics 2024Quote: pCDF5-U6-[4xgRNA-tRNA]-GFP was generated by cloning the 4 gRNAs targeting GFP from (Ma et al., 2016) in pCDF5 (Addgene #Plasmid #73914) (Port and Bullock ...
-
bioRxiv - Neuroscience 2021Quote: ... under a flex promoter was obtained from the University of Pennsylvania Vector Core (AAV2/9.Syn.Flex.GCaMP6f.WPRE.SV40, CS0641, Penn Vector Core via Addgene). Lateral septum viral injections were targeted at the following coordinates ...
-
bioRxiv - Neuroscience 2021Quote: ... and AAV.Syn.NES-jRGECO1a.WPRE.SV40 (Serotype 2/9; titer ≥ 1×1013 vg/mL) viruses were purchased from Addgene.
-
bioRxiv - Microbiology 2020Quote: ... CRISPR/Cas-9 vectors were derived from the plasmid lentiCRISPRv2 (a gift from Feng Zhang; Addgene plasmid # 52961 ...
-
bioRxiv - Neuroscience 2023Quote: ... 0.3 μl of AAV2/9-CAG-ChR2-mCherry (3 × 1012 genomic copies per mL, Addgene, 100054) or AAV2/9-CAG-mCherry (2.85 × 1012 genomic copies per mL ...
-
bioRxiv - Cancer Biology 2023Quote: ... pLKO.1 and pLKO.5 were sourced from Addgene (#1864; a gift from David Sabatini 9) and Sigma-Aldrich (St ...
-
bioRxiv - Bioengineering 2023Quote: ... we followed the protocol of our previous study20 to transfected 6 individually isolated fibroblast lines with 4 μg of episomal plasmid (#58527; Addgene, Watertown, MA, USA) using the NucleofectorTM II with the A-024 program (Amaxa ...
-
bioRxiv - Neuroscience 2023Quote: ... each of these viruses were mixed in a 4:1 ratio with AAV8-Ef1a-double floxed-hChR2(H134R)-mCherry-WPRE-HGHpA (Addgene; Watertown, MA, USA) and injected with 300 nL per side ...
-
bioRxiv - Cell Biology 2023Quote: ... pcDNA3.1-myc-OGA(1-400) and (344)pcDNA3.1(+)-HA-nLaG6-(EAAAK)4-OGA(544-706)15 (gift from Christina Woo; Addgene plasmid 168095 and 168197). Additionally ...
-
bioRxiv - Cancer Biology 2024Quote: HEK293 cells were cultured in 6-well plates and then transfected with 4 μg of previously described plasmid vectors encoding ER stress reporter genes ATF4-mS (#115970, Addgene, Cambridge, MA, USA), XBP1-mN (#115971) ...
-
bioRxiv - Cell Biology 2024Quote: ... expressing a gRNA targeted against hTUBA1B (gGATGCACTCACGCTGCGGGA) and an mEGFP plasmid with 1 kb homology arms (AICSDP-4:TUBA1B-mEGFP, Allen Institute, Addgene plasmid # 87421; RRID:Addgene_87421)41 mutated for the gRNA binding site ...
-
bioRxiv - Neuroscience 2024Quote: ... For fiber photometry experiments Fig 4 and 4S: dual virus strategy of AAVretro-pEF1a-DIO-FLPo-WPRE-hGHpA (Addgene; 87306-AAVrg; 7×10e12) in PPN and AAVDJ-hEF1a-dFRT-jGCaMP7s(rev)-dFRT-WPRE-hGHp(A ...
-
bioRxiv - Neuroscience 2024Quote: ... Gq DREADD virus (n=23, 12 males, 11 females: AAV8-hSyn-DIO-hM3Dq-mCherry, ≥ 4×101 2 vg/mL, Addgene; Watertown, MA, USA) was mixed with GAD1-cre to express excitatory designer receptors in VP GABA neurons ...
-
bioRxiv - Microbiology 2020Quote: ... 9 µg of psPAX2 (a gift from Didier Trono (Addgene plasmid # 12260 ; http://n2t.net/addgene:12260; RRID:Addgene_12260), and 3 µg of pCAGGS-S (SARS-CoV-2)(Catalog No ...
-
bioRxiv - Neuroscience 2021Quote: ... 8-9 20 nL injections of AAV1-Syn-flex-GCaMP6s (Addgene #100845-AAV1, Chen et al., 2013) were delivered to the RSC (AP ...
-
bioRxiv - Neuroscience 2022Quote: ... versus a respective control virus AAV2/1-DIO-hSYN1-mCherry (Addgene # 50459; titer: 9 × 1012 gc/ml). To ablate PVNOT neurons ...
-
bioRxiv - Neuroscience 2024Quote: The plasmid WPRE-ab (pAAV/mIba1.GFP.WPRE.miR-9.T.miR-129-2-3p.T.SV40pA) was obtained from previous studies in our laboratory (Addgene plasmid #190163). The plasmid CAG-eYFP-3x-miR708-5p-TS was a gift from Viviana Gradinaru (Addgene plasmid #117381 ...
-
bioRxiv - Cancer Biology 2020Quote: WM266-4 or SK-MEL-2 cells were co-transduced with conditioned media containing lentiviruses bearing Firefly luciferase-7TFP (Addgene #24308, β-catenin reporter) and Renilla luciferase pLenti.PGK.blast-Renilla Luciferase (Addgene #74444 ...
-
bioRxiv - Biochemistry 2022Quote: CRISPR-Cas9-mediated gene ablation was carried out using a guide RNA targeting Cmas exon 4 (5’-TGTCGACGAGGCCGTTTCGC-3’) in the plasmid pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene plasmid #42230 from Feng Zhang) as used before.11 TSC were cotransfected with GFP-expressing plasmid peGFP-CI (Clontech ...
-
bioRxiv - Neuroscience 2024Quote: ... polyA_R, Table 3) and plasmid backbone (Col1E_F, Col1E_R, Table 4) were amplified from pPRISM-Stop-cmlc2-eGFP (Addgene kit #1000000154; Wierson et al., 2020). The PCR-amplified fragments were assembled using NEBuilder HiFi DNA Assembly Cloning Kit (E5520S ...
-
bioRxiv - Neuroscience 2024Quote: ... For optogentic activation of the glutamatergic PPN in Figure 3S: AAV5-Ef1a-DIO-hChR2-(E123T/T159C)-eYFP-WPRE was injected into the PPN (Addgene, 35509-AAV5, 4×10e12). For chemogenetic experiments in Figure 4 and 4S ...
-
bioRxiv - Microbiology 2020Quote: ... 9 µg of pLV-eGFP (a gift from Pantelis Tsoulfas (Addgene plasmid # 36083; http://n2t.net/addgene:36083; RRID:Addgene_36083), 9 µg of psPAX2 (a gift from Didier Trono (Addgene plasmid # 12260 ...
-
bioRxiv - Cancer Biology 2020Quote: ... H357 and SCC-9 cells were transfected with RRBP1 overexpression plasmids pcDNA4 HisMax-V5-GFP-RRBP1(Addgene:Cat#92150) using the ViaFect transfection reagent (Promega Cat# E4982) ...
-
bioRxiv - Neuroscience 2020Quote: ... pAAV-Ef1a-DIO hChR2 (E123T/T159C)-EYFP (gift from Karl Deisseroth, packaged into AAV serotype 9 from Addgene, plasmid # 35509 ...
-
bioRxiv - Cell Biology 2023Quote: ... HEK293T cells (between passage 9-11) were transfected with lentiviral packaging vector psPAX2 (#12259, Addgene, Watertown, MA, USA), the envelope vector pMD2.G (#12260 ...
-
bioRxiv - Microbiology 2022Quote: ... PCDNA3-GFP1-9 T2A mCherry was a gift from Xiaokun Shu (Addgene plasmid # 124430;http://n2t.net/addgene:124430; RRID:Addgene_124430) (PMID ...
-
bioRxiv - Immunology 2022Quote: shRNAs were designed to target human Galectin-9 mRNA and cloned into the pLKO.1 vector (Addgene #10878). The sense shRNA sequences are CCTGGTGCAGAGCTCAGATTT (shGal-9 #1 ...
-
bioRxiv - Immunology 2022Quote: ... RAW 264.7 macrophages were transduced with lentiviral particles containing Gal-9-3xFLAG expressed from pLenti-puro (Addgene #39481). Primary murine bone marrow-derived macrophages (BMMs ...
-
bioRxiv - Neuroscience 2024Quote: ... We used the following viral constructs and injection volumes per site in the different types of experiments: AAV.9.Syn.Flex.GCaMP6f.WPRE.SV40 (calcium recordings 140 nl; Addgene, no. 100833); AAV.1.hSyn.dio.EGFP (anterograde labelling ...
-
bioRxiv - Neuroscience 2021Quote: ... We bilaterally injected 368 nl of AAV2/9 hSyn.hChR2(H134R).eYFP.WPRE.hGH (UPenn Vector Core) or AAV2/9 CaMKII.ArchT-GFP (UNC Vector Core) or pGP-AAV-syn-jGCaMP7f-WPRE (Addgene) to the LEC or MEC ...
-
bioRxiv - Microbiology 2021Quote: ... the TEV FlipGFP plasmid PCDNA3-FlipGFP(TEV cleavage seq) T2A mCherry (Addgene, #124429, a gift from Xiaokun Shu [9]) was used as a template for pairs of PCR reactions including primers designed to generate overlapping products replacing the TEV cleavage site with the indicated cleavage sequence (S9 Table) ...
-
bioRxiv - Neuroscience 2022Quote: ... we injected either rAAV2/9 encoding GCaMP6s (Chen et al., 2013) under control of the CaMKII promoter (1.25 × 1013 gc/ml; AddGene viral prep #107790-AAV9 ...
-
bioRxiv - Neuroscience 2022Quote: ... or rAAV2/9 encoding for NIR-GECO2 under control of the synthetic CAG promoter (0.5 × 1012 -1 × 1013 gc/ml; AddGene plasmid #159603 ...
-
bioRxiv - Neuroscience 2022Quote: ... PV mice (n=9) were infused with AAV9-CAG-FLEX-SomArchon-GFP (titer: 6.3×1012 – 1.1×1013 GC/mL, Addgene #126943) or AAV9-synapsin-FLEX-SomArchon-GFP (titer ...
-
bioRxiv - Immunology 2021Quote: ... and the third exon of NCR3 (conserved in 3 of the 4 longest isoforms of NCR3 with transcript ID ENST00000376073) were designed and cloned into the lentiCRISPR V2 vector (Addgene #52961, sgRNA sequences in Table S1). Lentiviruses were produced in HEK293T cells using standard laboratory protocols ...
-
bioRxiv - Bioengineering 2020Quote: ... The eluted fractions were then pooled together and underwent TEV cleavage overnight at 4°C (TEV protease was purified using the plasmid pRK793, #8827 from Addgene, a gift from David Waugh Lab).
-
bioRxiv - Neuroscience 2024Quote: ... a 448 bp human synapsin-1 promoter element driving the neuronal specific expression of 4) the fluorescent protein mTagBFP2 (Addgene plasmid #191566 pLKO.1-TRC mTagBFP2) fused to the plasma membrane targeting sequence CAAX2 (Addgene plasmid #162247 ...
-
bioRxiv - Microbiology 2020Quote: ... were plated in a 100-mm tissue culture dish and transfected the next day when they were about 75% confluent with a combination of the following plasmids: 9 µg of pLV-eGFP (a gift from Pantelis Tsoulfas (Addgene plasmid # 36083 ...
-
bioRxiv - Neuroscience 2022Quote: ... between the age of P60 and P120 (n = 6) were injected with virally encoded Cre-dependent GCaMP in PFC (~300 nl, AAV2/9 flex GCaMP6f, Addgene) and Cre in LEC (140 nl at each site ...
-
bioRxiv - Genomics 2022Quote: ... 12 μg of plasmid library was cotransfected with 9 μg psPAX2 and 3 μg pMD2.G (Addgene #12260 and #12259) into HEK293FT cells using 72 μl Lipofectamine 2000 (Life Technologies #11668019) ...
-
bioRxiv - Neuroscience 2021Quote: Cre-dependent adeno-associated virus (AAV; serotypes 5 or 9) was used to express GCaMP6s (AAV5-Syn-Flex-GCaMP6s, Addgene), or GCaMP7f (AAV9-Syn-Flex-jGCaMP7f-WPRE ...
-
bioRxiv - Neuroscience 2020Quote: ... and 0.1 μL of adeno-associated virus serotype 9 (AAV9) carrying GCaMP6f under the excitatory neuronal promoter CaMKII (AAV-CaMKII-GCaMP6f) (Addgene) to co-transfect the TRPV1 and GCaMP6f into neurons.
-
bioRxiv - Neuroscience 2021Quote: Cultured Cdh11 wild-type and knockout hippocampal neurons (300,000 cells/2 cm2) were transfected at 3 DIV or 9 DIV with the pLL3.7-GFP vector (Addgene Cat#11795) using Lipofectamine 2000 (Invitrogen Cat#11668-019 ...
-
bioRxiv - Neuroscience 2023Quote: ... University of Zurich (purified by VVF as v723-9; AAV9-hCMV-HA-SpCas9, Addgene 106431, gift from Juan Belmonte [22]).