Labshake search
Citations for Addgene :
151 - 200 of 736 citations for tert Butyl 10 oxo 4 9 diazaspiro 4.5 decane 4 carboxylate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... 4 x 105 cells from the previous transfection were transfected with pCMV-PEmax (Addgene: 174820)11 (800 ng ...
-
bioRxiv - Cancer Biology 2022Quote: ... sgFIGNL1#4: CCTATACCCAAGCAAGATGG) were cloned into lentiCRISPRv2 (a gift from Feng Zhang, Addgene plasmid #52961) in a single-step digestion-ligation reaction (2 hours (h ...
-
bioRxiv - Neuroscience 2022Quote: [4] DsRed from pBac-DsRed-ORCO_9kbProm-QF2 (a gift from Christopher Potter, Addgene ID #104877) (Riabinina et al. ...
-
bioRxiv - Neuroscience 2024Quote: ... oligonucleotide pairs (Supplemental Table 4) were used for PCR and inserted into pCFD5 (Addgene #73914) via Gibson Assembly ...
-
bioRxiv - Neuroscience 2024Quote: ... oligonucleotide pairs (Sup. Table 4) were used for PCR and inserted into pCFD5 (Addgene #73914)77 via Gibson Assembly.
-
bioRxiv - Microbiology 2020Quote: ... 9 µg of psPAX2 (a gift from Didier Trono (Addgene plasmid # 12260 ...
-
bioRxiv - Neuroscience 2022Quote: We obtained the AAV serotype 9 hSyn-Cre from Addgene (#105555 ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV.9.Ef1A.fDIO.EYFP (control for optogenetics, 140 nl, Addgene, no55641).
-
bioRxiv - Neuroscience 2024Quote: ... they were co-transfected with GFP1-9::iRFP702 (Addgene #130125), mouseTenms(N-terminus)-GFP10::mCHERRY ...
-
bioRxiv - Cell Biology 2022Quote: ... HEK293T cells were cultured in 10-cm dishes and transiently transfected with 9 μg lentiviral plasmid pLV-ER-GFP (Cat# 80069, Addgene, a gift from Pantelis Tsoulfas), 8 μg pCMV-dR8.91 ...
-
bioRxiv - Neuroscience 2024Quote: ... We used Th-cre mice and injected 375nl AAV2/9-CAG-Flex-ChR2-tdTomato into the VTA and infused 450nl AAV9.CamKII.GCaMP6s.WPRE.SV40 (Addgene 107790-AAV9, 2.5 x 10^13 GC/mL) into M2 (Bregma ...
-
bioRxiv - Cancer Biology 2022Quote: ... pLenti CMV GFP Hygro (656-4) was a gift from Eric Campeau and Paul Kaufman (Addgene plasmid #17446 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Fibroblasts were reprogrammed by electroporation delivery of episomal vectors pCXLE-hOCT3/4-shp53-F (Addgene, 27077), pCXLE-hSK (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: ... we infected 4 DIV neurons with adeno-associated virus (AAV) expressing CamK2a-Cre (Addgene# 105558-AAV1) - pENN.AAV.CamKII 0.4.Cre.SV40 was a gift from James M ...
-
bioRxiv - Neuroscience 2024Quote: ... The he1.1:YFP cassette (he1.1:YFP_F, he1.1:YFP_R, Table 4) was amplified from p3E_he1a:YFP (Addgene, plasmid #113879), and the polyA terminator (polyA_F ...
-
bioRxiv - Molecular Biology 2024Quote: ... Purified ULP1 protease was added to the eluent overnight at 4°C (pFGET19_Ulp1, Addgene, Watertown, MA). The cleaved product was loaded onto a Ni column (Cytvia HisTrap™ High Performance ...
-
bioRxiv - Cancer Biology 2023Quote: ... the following lentiviral vectors were used at an MOI of 4 (96h): pWPXL-SOX4 (Addgene 36984), HA-tagged SOX4 [43] or empty vector control (Addgene 12257) ...
-
bioRxiv - Neuroscience 2023Quote: ... Mice were injected at 4 weeks of age with pENN.AAV.CamKII.HI.GFP-Cre.WPRE.SV40 (Addgene viral prep # 105551-AAV9) in the right hemisphere to silence Tsc1 gene and pENN.AAV9.CamKII0.4.eGFP.WPRE.rBG (Addgene viral prep # 105541-AAV9 ...
-
bioRxiv - Cell Biology 2023Quote: ... pLenti CMV GFP Hygro (656-4) was a gift from Eric Campeau and Paul Kaufman (Addgene plasmid # 17446 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4-hydroxytamoxifen-inducible Rosa26::CreERT2 embryo and immortalized by transduction of pMXs-hc-MYC (Addgene 17220) followed by limiting dilution and clone derivation (see “iMEF B” in ref ...
-
bioRxiv - Synthetic Biology 2024Quote: pHB-4 was a gift from Kang Zhou (Addgene plasmid # 140957 ; http://n2t.net/addgene:140957 ; RRID:Addgene_140957)
-
bioRxiv - Neuroscience 2024Quote: ... pAAV-hDlx-GqDREADD-dTomato-Fishell-4 was a gift from Gordon Fishell (Addgene, 162375-AAV9 Addgene) (32) ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV-hDlx-GqDREADD-dTomato-Fishell-4 was a gift from Gordon Fishell (Addgene, 162375-AAV9 Addgene) (32) ...
-
bioRxiv - Neuroscience 2024Quote: ... slices were transduced with a total of 4 viruses: AAV9-CamKII(0.4)-Cre (Addgene plasmid #105558), AAV9-EF1a-DIO-hChR2(H134R)-EYFP (Addgene plasmid #20298) ...
-
bioRxiv - Cell Biology 2024Quote: ... myofibers at differentiation day 3-4 were infected using 1 μl/ml of the AAV9-pAAV.CAG.GCaMP6s.WPRE.SV40 (Addgene viral prep # 100844-AAV9 ...
-
bioRxiv - Neuroscience 2020Quote: Brainbow3.0 AAV-2/9 and AAV-PhP.EB were obtained from Addgene and University of Michigan vector core ...
-
bioRxiv - Neuroscience 2021Quote: The adenoassociated virus (AAV) pAAV2/9.CAG.FLEX.GCaMP6s.WPRE.SV40 was purchased from Addgene (Addgene viral prep #100842-AAV9 ...
-
bioRxiv - Biophysics 2022Quote: ... pCMV-mCherry-FilaminA-N-9 (Addgene #55047, gift from Michael Davidson), pCMV-mEmerald-Alpha-Actinin-19 (Addgene #53989 ...
-
bioRxiv - Neuroscience 2023Quote: ... and AAV2/9-pAAV-hDlx-hM4Di-dTomato-Fishell-5 (Addgene, 83896) at a concentration of 6+13 genome copies per ml (gc/ml) ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV.9.FLEX.rev.ChR2(H134R).mCherry (optogenetics, 140 nl, Addgene, no. 18916), AAV.9.Ef1A.fDIO.EYFP (control for optogenetics ...
-
bioRxiv - Microbiology 2024Quote: ... HEK293T cells were cultured in 10-cm dishes and transiently transfected with 9 µg lentiviral plasmid pLV-ER-GFP (Addgene, 80069, a gift from Pantelis Tsoulfas), 8 µg pCMV-dR8.91 ...
-
bioRxiv - Neuroscience 2024Quote: The AAV9 hM4D DREADD (AAV-hSyn-DIO-hM4D(Gi)-mCherry) (titer = 4.5 × 1012 vg/mL; Addgene; 44362-AAV9) and the AAV9 hM3D DREADD (AAV-hSyn-DIO-hM4D(Gq)-mCherry ...
-
bioRxiv - Biochemistry 2022Quote: Human Drp1 (Uniprot ID: O00429-4) with a C-terminal StrepII tag in pET15b (Addgene plasmid #174428) was expressed in BL21(DE3 ...
-
bioRxiv - Microbiology 2021Quote: ... 4-363h21C1 and 3-978h1C1 and were cloned into lentiviral vector pLKO.1-puro (Addgene, catalogue #8543). Lentiviral vectors were produced in 293T cells by Fugene transfection and the supernatant was used to infect Jurkat cells ...
-
bioRxiv - Microbiology 2021Quote: ... pLenti CMV GFP Hygro (656-4) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid # 17446) (Campeau et al. ...
-
bioRxiv - Genetics 2021Quote: The Drosophila CRISPR genome-wide knockout library was previously described and is available from Addgene (134582-4)20,55 ...
-
bioRxiv - Neuroscience 2024Quote: ... was injected with a mixture of Cre-expressing and Cre-dependent adeno-associated viral vectors carrying the genes for ChR2 and tdTomato (AAV9.CamKII.4.Cre.SV40 and AAV9.CAG.Flex.ChR2.tdTomato, Addgene). Following a post-injection survival period of 9 weeks ...
-
bioRxiv - Cell Biology 2023Quote: Linear tetra-ubiquitin fused to GST (GST-4×Ub) was cloned into a pGEX-4T1 vector (RRID:Addgene_199779). After the transformation of the pGEX-4T1 vector encoding GST-4×Ub in E ...
-
bioRxiv - Microbiology 2022Quote: ... The HA-NFAT1(4-460)-GFP plasmid was a gift from Anjana Rao (Addgene plasmid # 11107 ;; RRID:Addgene_11107) [50] ...
-
bioRxiv - Microbiology 2022Quote: ... The HA-NFAT1(4-460)-GFP plasmid was a gift from Anjana Rao (Addgene plasmid # 11107 ;; RRID:Addgene_11107) [50] ...
-
bioRxiv - Cancer Biology 2023Quote: ... They were then transduced with lentivirus containing the plasmid pLenti_CMV_GFP_Hygro [pLenti CMV GFP Hygro (656-4) was a gift from Eric Campeau & Paul Kaufman (Addgene viral prep # 17446-LV ...
-
bioRxiv - Neuroscience 2023Quote: 1-4 evenly spaced ∼60 nl injections of the AAV1-synapsin-l-GCamp6f (Addgene, MA stock #100837) that had been diluted to a titer of ∼1×10^12 vg/mL using sterile PBS were made in each cranial window ...
-
bioRxiv - Molecular Biology 2024Quote: ... Lenti dCAS-VP64_Blast (4) was a gift from Feng Zhang (Addgene plasmid # 61425; http://n2t.net/addgene:61425; RRID:Addgene_61425). lenti MS2-P65-HSF1_Hygro (4 ...
-
bioRxiv - Molecular Biology 2024Quote: ... lenti MS2-P65-HSF1_Hygro (4) was a gift from Feng Zhang (Addgene plasmid # 61426; http://n2t.net/addgene:61426; RRID:Addgene_61426). lentiMPH v2 (20 ...
-
bioRxiv - Cell Biology 2024Quote: ... a total of 3.65 μg DNA vectors including 0.47 μg pCE-hOCT3/4 (Addgene, MA, U.S.A, #41813), 0.47 μg pCE-hSK (Addgene ...
-
bioRxiv - Cell Biology 2024Quote: ... 4 week-old male p62 fl/fl mice were transduced with pAAV.TBG.PI.eGFP.WPRE.bGH (AAV8) (Addgene item #105535-AAV8) or AAV.TBG.PI.Cre.rBG (AAV8 ...
-
bioRxiv - Developmental Biology 2024Quote: ... unc-4 and vab-7 homology arms were cloned into the mNG-SEC plasmid pDD268 (Addgene #132523). Primers are listed in Supplemental Table S1.
-
bioRxiv - Developmental Biology 2024Quote: ... Each dsDNA was injected into CB4088 hermaphrodites at a final concentration of 10 µM with 9 ng plasmid pCFJ90 (Addgene #19327, myo-2>mCherry::unc-54 ‘UTR) as an injection marker ...
-
bioRxiv - Cancer Biology 2022Quote: ... and hAHRΔe8-9 sequences were cloned in a lentiviral plasmid (Addgene #52961) and subsequently to pcDNA3.1 vector with the In-fusion HD Eco-dry cloning (Takarabio) ...
-
bioRxiv - Cell Biology 2021Quote: ... We used TALENs targeting exon 9 of RBM20 (Addgene #108342 and #108343) to generate the RBM20 R636S Het iPSC line ...