Labshake search
Citations for Addgene :
301 - 350 of 509 citations for Tetratricopeptide repeat protein 14 TTC14 Antibody since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... expressing the genetically encoded calcium indicator GCaMP6f under control of the calcium/calmodulin-dependent protein kinase (CaMKII) promoter (pENN.AAV5.CAMKII.GCaMP6f.WPRE.SV40, Addgene, Watertown, MA). Virus (0.5 µl ...
-
bioRxiv - Biochemistry 2023Quote: ... as described in Janecek et al.39 Aurora B protein was expressed from plasmid pNIC28-AurB (Addgene 39119).
-
bioRxiv - Developmental Biology 2023Quote: ... The protein coding sequence of Lck-GFP was amplified from the Lck-GFP plasmid (Catalog no.61099, Addgene) using Phusion high fidelity polymerase (Catalog no ...
-
bioRxiv - Neuroscience 2024Quote: ... the coding sequence of the chimeric protein unc84:2xGFP17 was isolated from the original pMUH_unc84_2XGFP plasmid (Addgene #46023) via PCR using the following primers (5’-AACAGATCTGCGGCGGCAAAATGGCTCCCGCAACGGAAG-3’ and 5’-CGGCCCCTAGGGCGGTCACACCACAGAAGTAAGG-3’) ...
-
bioRxiv - Biochemistry 2024Quote: ... His6-tagged proteins were cleaved with TEV protease (expressed and purified in-house from plasmid pRK793 (Addgene #8827)) 29 then passed over a HisTrap HP column (Cytiva ...
-
bioRxiv - Microbiology 2020Quote: ... The plasmid used for constructing recombinant virus was pVSVΔG-eGFP (where eGFP is enhanced green fluorescent protein; plasmid 31842; Addgene). GPC was cloned into the ΔG site ...
-
bioRxiv - Immunology 2022Quote: ... To subclone the fusion protein constructs GFPNKG2D-S/L into the retroviral stem cell vector pMIGR1 (Addgene, plasmid 27490), forward 5’ TAGTAGGAATTCGCCACCATGAGCGGGGGCGAGGAC 3’ and the reverse 5’ TAGAGGTCGACCTTACACCGCCCTTTTCATGCAG3’ primers were used ...
-
bioRxiv - Neuroscience 2021Quote: ... The plasmids for expression of zinc finger fusion-proteins were newly generated based on the following cDNAs: pMT2 CaVβ1b GFP (gift from Annette Dolphin obtained through Addgene, plasmid # 89893 ...
-
bioRxiv - Immunology 2021Quote: ... and a plasmid encoding the spike protein (with a C-terminal truncation) from either SARS-CoV (Addgene cat 170447), SARS-CoV-2 53 ...
-
bioRxiv - Biochemistry 2020Quote: The cDNAs for protein expression in this study were as follows: DCLK1 (Transomic, BC133685) and Lambda phosphatase (Addgene, 79748). DCLK1 proteins were cloned in frame using Gibson cloning into a pET28 vector with an N-terminal strepII-Tag and a superfolder GFP (sfGFP ...
-
bioRxiv - Microbiology 2020Quote: ... The plasmids encoding the Spike protein were a mixture of (10 µg) of pcDNA3.1-SARS2-Spike (Addgene plasmid 145032) and (3 µg ...
-
bioRxiv - Microbiology 2021Quote: ... pCDNA3.1-SARS2-Spike expressing full-lengh Spike (S) protein from SARS-CoV-2 (GenBank accession number QHD43416.1) was purchased from Addgene. Expression plasmid encoding S protein from SARS-CoV (GenBank accession number AAP13567.1 ...
-
bioRxiv - Microbiology 2021Quote: ... vector pCMV-VSV-G for expression of the protein G from vesicular stomatitis virus (# 8454) were obtained from Addgene; reporter plasmids pUCHR-inLuc-mR and pUCHR-IR-GFP were described previously 37,38 ...
-
bioRxiv - Immunology 2022Quote: A lentivirus expressing the ASC-GFP fusion protein was prepared by transfection of pLEX-MCS-ASC-GFP (Addgene 73957), psPAX2 ...
-
bioRxiv - Microbiology 2022Quote: ... The lentiviral vector plasmid pSICO-CPSF6-mNeonGreen encoding CPSF6 fluorescent fusion protein was a gift from Zandrea Ambrose (Addgene plasmid # 167585 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... a plasmid containing cloned wild type AlkB protein (pET24a-AlkB deltaN11 [plasmid #73622]) was obtained from Addgene (http://www.addgene.org/), and the AlkB protein was expressed and purified at the CSU Biochemistry and Molecular Biology Protein Expression and Purification Facility.
-
bioRxiv - Biochemistry 2021Quote: ... by cloning our codon optimized Syx gene into vectors containing the following tags that are cleavable with tobacco etch virus (TEV) protease: N-terminal His6 plus maltose binding protein (MBP; RRID:Addgene_29708); C-terminal MBP plus His6 (Addgene_37237) ...
-
bioRxiv - Microbiology 2021Quote: ... GFP-LMP2 and mStrawberry-Ub fusion proteins were constructed by transfecting hBMECs with pBABEpuro LC3-GFP vector (Addgene, 22405), pMRX-IRES-GFP-LMP2 (GFP-LMP2 was subcloned from pCND3-GFP-LMP2 ...
-
bioRxiv - Immunology 2020Quote: ... A plasmid library of sgRNAs targeting all protein coding genes in the mouse genome (Brie Knockout library, Addgene 73633) was packaged into lentivirus using HEK293T cells ...
-
bioRxiv - Neuroscience 2022Quote: ... The constructs were provided with a packaging vector (Pax2, 12.5 µg) and the envelope protein VSV-G (3.3 µg, Addgene, #8454) in Opti-MEM medium to which the transfection reagent Polyethylenimine (1 mg/ml ...
-
bioRxiv - Neuroscience 2022Quote: ... a mammalian expression vector encoding an EGFP-human 0N4R tau fluorescent fusion protein was obtained from Addgene (catalog # 46904). This plasmid was developed by the lab of Karen Ashe [16] ...
-
bioRxiv - Genetics 2024Quote: Human pcDNA3-FLAG-RBBP5 plasmid used in the protein expression experiments was obtained from Addgene (Cat# 15550, MA, USA). Candidate variants were introduced using QuikChange II Site-directed mutagenesis kit according to manufacturer’s protocol (Agilent ...
-
bioRxiv - Neuroscience 2023Quote: We transiently expressed the phototoxic KillerRed protein in Tg(SAIG213A:EGFP) fish by injecting a plasmid expressing KillerRed driven by UAS promoter (Addgene plasmid # 115516 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Prokaryotic plasmids encoding GST-fusion proteins were constructed using pGEX-4T-1 bacterial expression vector (27-4580-01, Addgene). Mutants of His- ...
-
bioRxiv - Immunology 2023Quote: The expression construct used to generate SARS-CoV-2 spike protein was a gift from Jason McLellan (Addgene #154754). Spike protein was prepared as previously described in20 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... that have reached ~80-90% confluency with the second generation pHR plasmid carrying the desired transgene (Supplementary Table S2) and the vectors encoding for the packaging proteins (pCMVR8.74; gift from Didier Trono (Addgene plasmid # 22036 ...
-
bioRxiv - Systems Biology 2022Quote: ... or 1-2 x 105 cells/mL for pCL040-based inducible protein expression vectors (to be deposited on Addgene) to account for differences in infection efficiency ...
-
bioRxiv - Immunology 2023Quote: CTLs were transiently transfected with the pEGFP plasmid encoding the EB1-GFP fusion protein (Addgene #17234, Watertown, Massachusetts, USA). Briefly ...
-
The tetrapeptide sequence of IL-1β regulates its recruitment and activation by inflammatory caspasesbioRxiv - Immunology 2023Quote: ... DNA encoding the indicated proteins were inserted between the attR recombination sites and shuttled into modified pLEX_307 vectors (Addgene) using Gateway technology (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2023Quote: Fusion protein expression cassettes were cloned into the lentiviral expression vector LeGO-G2 (kind gift from Boris Fehse, Addgene plasmid #251917 ...
-
bioRxiv - Cell Biology 2023Quote: ... Lentivirus were packaged by co-transfection of the transfer plasmid encoding the protein of interest with psPAX2 (Addgene #12260) and pVSVG (Addgene # 35616 ...
-
bioRxiv - Bioengineering 2023Quote: ... by transfection with the lentiviral transfer vector plasmid (pWPI) that contains enhanced green fluorescent protein (eGFP) (Addgene plasmid # 12254), and provided by Dr ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... The β-arrestin2 green fluorescent protein (GFP) plasmid DNA was originally created by Robert Lefkowitz and obtained from Addgene (plasmid #35411 ...
-
bioRxiv - Neuroscience 2024Quote: Plasmids containing degenerated protein-coding sequences of wild type and mutated D290V hnRNP A2 isoforms were purchased by Addgene. hnRNP B1 sequence were amplified by PCR from hnRNP A2 plasmid ...
-
bioRxiv - Biochemistry 2024Quote: ... The fluorescent protein stability reporter of GSPT1 was generated by inserting GSPT1 coding sequence into pArtichoke plasmid (Addgene 73320) by Gibson assembly.
-
bioRxiv - Cancer Biology 2024Quote: ... together with: (i) an expression vector for the VSV-G envelope protein (pCMV-VSV-G, Addgene 8454; RRID: Addgene_8454), (ii ...
-
bioRxiv - Cancer Biology 2024Quote: ... together with: (i) an expression vector for the VSV-G envelope protein (pCMV-VSV-G, Addgene 8454; RRID: Addgene_8454), (ii ...
-
bioRxiv - Cell Biology 2024Quote: ... the protein phosphatase was fused to a N-terminal 6xHis-tag through cloning into a pET-DUET1 vector (RRID:Addgene_223747). After the transformation of the pET-DUET1 vector encoding 6xHis-TEV-λ PPase in E ...
-
bioRxiv - Biochemistry 2024Quote: ... His6-tagged proteins were cleaved with TEV protease (expressed and purified in-house from plasmid pRK793, Addgene ID 8827)34 then passed over a HisTrap HP column (Cytiva ...
-
bioRxiv - Molecular Biology 2024Quote: The exogenous TDP-43 plasmids were constructed in a pCMV backbone by linking a 3xFlag-APEX2 protein (Addgene #164622) (Bonet-Ponce et al. ...
-
An mRNA processing pathway suppresses metastasis by governing translational control from the nucleusbioRxiv - Cancer Biology 2021Quote: ... MDA-LM2 and HCC1806-LM2 cells expressing dCas9-KRAB fusion protein were constructed by lentiviral delivery of pMH0006 (Addgene #135448) and FACS isolation of BFP-positive cells.
-
bioRxiv - Cancer Biology 2021Quote: Cas9-expressing stable cell lines were produced by infection with the lentivirus encoding human codon-optimized Streptococcus pyogenes Cas9 protein (LentiV_Cas9_puro, Addgene plasmid # 108100) and subsequent selection with 1 μg/mL puromycin ...
-
bioRxiv - Cancer Biology 2021Quote: ... The EGFP-TUBA1B fusion protein was subcloned into pDONR221 and was subsequently cloned into pLX303 (from David Root, Addgene #25897). CyclinB1-GFP was amplified using PCR (donor plasmid ...
-
bioRxiv - Microbiology 2021Quote: Mycobacterium marinum (ATCC 927) with the pTEC27 plasmid expressing the red fluorescent protein tdTomato (Addgene #30182, http://n2t.net/addgene:30182) (29 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... five nanoliters of a solution containing both sgRNAs at a concentration of 40 ng/μL and Cas9 protein (Addgene #47327) at a concentration of 250 ng/μL32 was injected into one-cell-stage medaka embryos ...
-
bioRxiv - Biochemistry 2022Quote: ... was made by ligating a PCR fragment encoding full-length human protein between ApaI and BamHI sites of pHis10-PS-SNAPf (75) (gift from Ron Vale; Addgene plasmid #78512 ...
-
bioRxiv - Neuroscience 2021Quote: ... the plasmid carrying spike protein sequence (Miaoling Plasmid Sharing Platform plasmid #P18156) was co-transfected with psPAX2 (Addgene plasmid #12260) into HEK293T cell line using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Molecular Biology 2021Quote: ... and TopBP1 was produced as a fused protein with a GST-tag (GST TopBP1 (aa 32-1522) His from Addgene; plasmid # 20375) ...
-
bioRxiv - Bioengineering 2020Quote: Libraries of linear DNA fragments encoding variants of the designed proteins were transformed together with linearized pCTcon2 vector (Addgene #41843) based on the protocol previously described by Chao and colleagues (68) ...
-
bioRxiv - Cancer Biology 2020Quote: ... A549 cells were retrovirally transduced with a construct coding for the N-terminus of 53BP1 fused to the sequence coding for fluorescent mCherry-protein (Addgene Catalog # 19835 ...