Labshake search
Citations for Addgene :
51 - 100 of 509 citations for Tetratricopeptide repeat protein 14 TTC14 Antibody since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2021Quote: ... proliferating HMECs were infected at PD 14 with pLenti-PGK-hygro (Addgene 19066) encoding either hTERT or firefly luciferase ...
-
bioRxiv - Developmental Biology 2021Quote: ... from the pCAG-CBE4max-SpG-P2A-EGFP plasmid (Addgene plasmid #139998)14 and from the pCAG-CBE4max-SpRY-P2A-EGFP plasmid (Addgene plasmid #139999)14.
-
bioRxiv - Developmental Biology 2023Quote: ... Plasmid with mCherry-2A-rTetR-CBX7 was created by subcloning mCherry-2A-rTetR (Addgene # 78101)14 and CBX7 into lentiviral expression vector backbone pLVU-tTR-KRAB (Addgene# 11645)71 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 14-3-3ζ was subcloned into pmTurquoise2-N1 (Addgene, Massachusetts, USA; plasmid # 54843) using restriction enzymes EcoRI (NEB ...
-
bioRxiv - Cell Biology 2023Quote: ... Most of the genes related with 14-3-3 were acquired from Addgene and cloned into pMX plasmids ...
-
bioRxiv - Cancer Biology 2024Quote: ... 14 and the transactivator FUW-M2rtTA (a gift from Rudolf Jaenisch; Addgene #20342) 15 ...
-
bioRxiv - Microbiology 2020Quote: ... The ace2 gene was amplified from a plasmid gifted by Hyeryun Choe 14 (Addgene plasmid # 1786 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The reporter constructs contained 14 UAS sites for Gal4-DBD binding (source: Addgene 128010), an enhancer and a core promoter ...
-
bioRxiv - Cell Biology 2023Quote: ... HEK293 cells were transfected with pFlagCMV2-14-3-3sigma (Addgene, Cambridge, MA, Plasmid #12453) (68) ...
-
bioRxiv - Immunology 2023Quote: ... and HLA-C0702 encoding cDNA (IDT) were inserted into pSBbi-GP[14] (Addgene plasmid # 60511) using the NEBbuilder HiFi Assembly Master Mix ...
-
bioRxiv - Neuroscience 2022Quote: ... [14] and low-titer Cre (AAV9-hSyn-Cre-WPRE-hGH; Addgene #105553, MOI = 5×103 vg) AAVs on DIV 7 ...
-
bioRxiv - Neuroscience 2022Quote: ... A pcDNA3 flag HA 14-3-3 β plasmid was a gift from William Sellers (Addgene plasmid # 8999 ...
-
bioRxiv - Molecular Biology 2021Quote: Human Δ43GTPBP6 was cloned into the pET-derived vector 14-C (gift from Scott Gradia; Addgene plasmid #48309 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... al.14 The pCS2-mNG-C (the CMV mNG plasmid) was purchased from Addgene (plasmid #128144).
-
bioRxiv - Immunology 2024Quote: ... pEMB52-14-3-3_1_247 (γ) was a gift from the Michael J Fox Foundation MJFF (Addgene #40541); pcDNA-HA-14-3-3β (Addgene #13270) ...
-
bioRxiv - Cancer Biology 2024Quote: ... The plasmid backbone sequence (p3xFLAG-CMV-14) was accessed from the Addgene vector database (Addgene ID: 1621) and custom-generated by Genscript ...
-
bioRxiv - Biochemistry 2021Quote: ... coli BL21(DE3) RIL from the pET-derived vector 14-B (a gift from S. Gradia; Addgene 48308) in LB medium individually ...
-
bioRxiv - Molecular Biology 2021Quote: Human Δ43GTPBP6 was cloned into the pET-derived vector 14-C (gift from Scott Gradia; Addgene plasmid #48309; http://n2t.net/addgene:48309; RRID:Addgene_48309) via ligation-independent cloning (primer sequences ...
-
bioRxiv - Microbiology 2020Quote: ... The ace2 gene was amplified from a plasmid gifted by Hyeryun Choe 14 (Addgene plasmid # 1786; http://n2t.net/addgene:1786; RRID:Addgene_1786) using CoV-39 and CoV-40 primers ...
-
bioRxiv - Biochemistry 2022Quote: ... The wild-type 14-3-3 ζ gene was cloned into NcoI/XhoI digested pBAD plasmid (Addgene #85482) with a TEV cleavable C-terminal His6 purification tag ...
-
bioRxiv - Molecular Biology 2024Quote: ... pcDNA-dCas9-p300 Core (14) was a gift from Charles Gersbach (Addgene plasmid # 61357; http://n2t.net/addgene:61357; RRID:Addgene_61357). Lenti dCAS-VP64_Blast (4 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Two guide RNAs (cgttcatatcctcgcgagta and cagccgagaccacgactacc) designed to target exon 3 (14-bp apart) were cloned into pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene), according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... A pcDNA3 flag HA 14-3-3 β plasmid was a gift from William Sellers (Addgene plasmid # 8999; http://n2t.net/addgene:8999; RRID:Addgene_8999). All plasmids were verified by Sanger sequencing and/or long-read sequencing (Iowa IIHG Genomics core or Plasmidsaurus ...
-
bioRxiv - Microbiology 2021Quote: ... The pcDNA-FLAG-V5-Nsp10/14/16 vectors were constructed from pDONR223 SARS-CoV-2 Nsp10 (Cat. # 141264, Addgene), Nsp14 (Cat ...
-
bioRxiv - Biochemistry 2023Quote: The 6xHis-SUMO-14-3-3ζ construct used in this work (kind gift of prof. B.M. Burmann) was derived from GST-14-3-3ζ (Addgene #13278)26 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5X106 purified T cells were electroporated (program U-14) in presence of the pT4.iC9.79D vector and the transposase SB100X plasmid (Addgene 34879) or of the transposase SB100X mRNA ...
-
bioRxiv - Cancer Biology 2024Quote: ... GST-SH2 SHC1 (#46486)13 and GST-SH2 (encompassing both the N- and C-terminus) SHP2 (#67575)14 were purchased from Addgene. Phospho-Y222 antibody was developed using peptide CDQRGQSI-pY222-STSFPQP ...
-
bioRxiv - Microbiology 2021Quote: ... The ZIKV sfRNA sequence and GFP gene fragment were PCR amplified from pUC19-ZIKV-F4 14 and pMYC-GFP (Addgene, #42142) plasmids respectively using primers HindIII_ZIKV_sfRNA and XbaI_GFP (Supplementary table 7 ...
-
bioRxiv - Neuroscience 2023Quote: ... The pAAV-hSyn-DIO-mCherry (titer 4.56 e+14 gc/ml) was produced in an in-house viral production facility using the plasmid ordered from Addgene (#50459). The pAAV2/9-pCAG-FLEX-alpha-synuclein(A53T)-3*Myc-WPRE (mutated pαSyn ...
-
bioRxiv - Microbiology 2023Quote: HPV16 PsVs were produced by co-transfecting 293TT cells with wild-type p16SheLL-3XFLAG tag [14] together with pCAG-HcRed (Addgene #11152) or pCINeo-GFP [obtained from C ...
-
bioRxiv - Genetics 2024Quote: ... To determine MOI and approximation of appropriate viral volume we infected day 14 iGLUTs (0, 1, 2, 4, 8, 10, 16, 32, 64 µL) with control lentivirus (pLS-SV40-mP-EGFP; AddGene #137724) and harvested for 48hrs later ...
-
bioRxiv - Cell Biology 2022Quote: A His-tagged mouse Capping Protein (F-actin-capping protein subunit alpha-1 and F-actin-capping protein subunit beta) plasmid was obtained from Addgene as described above (Plasmid #89950) ...
-
bioRxiv - Cell Biology 2020Quote: ... PA28γ ORF WT or minus the C-terminal 14 amino acids (ΔC) were cloned into pSBbi-Pur (a gift from E. Addgene plasmid #60523) according to (Kowarz et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... and female (n=14) rats underwent aseptic stereotaxic surgery for injection of 150nl retrograde-transducing AAV carrying fluorophore mCherry (pAAV-hSyn-mCherry; Addgene; 114472-AAVrg)) into the BLA (AP -3.0 ...
-
bioRxiv - Microbiology 2024Quote: ... The codon-optimized T7RNAP coding sequence was amplified from T7 opt in pCAGGS (14) (Addgene #65974; a kind gift from Benhur Lee) by PCR ...
-
bioRxiv - Genomics 2024Quote: The pBID-mphsp70-kozak-CD2-CmR/ccdB-25A-SV40polyA reporter plasmid (Supplementary Fig. 14) was generated from the pBID backbone vector (Addgene #35190, (61)) containing the mini-white gene as an integration marker ...
-
bioRxiv - Cell Biology 2024Quote: ... Unique duplexed 20 nucleotides long primers next to the PAM sequence (AGG) close to K631 (oACS13/14) were cloned into a replicative Cas9-KANMX plasmid (pEF562, Addgene plasmid #100955) to yield (pEF590 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Samples were incubated with Protein A/G-MNase fusion protein (Addgene, Cat #123461) at 700 ng/mL for 1 hour at 4°C ...
-
bioRxiv - Immunology 2021Quote: ... green fluorescence protein (GFP) or an enhanced yellow fluorescent protein (EYFP) sequence (pcDNA1.3-, Addgene) using standard cloning methods ...
-
Hippocampal efferents to retrosplenial cortex and lateral septum are required for memory acquisitionbioRxiv - Neuroscience 2020Quote: ... enhanced yellow fluorescent protein (eYFP) or enhanced green fluorescent protein (eGFP): AAV1.CaMKIIa.eNpHR3.0.eYFP.WPRE.hGH (Addgene, #26971), AAV1.CaMKII.eYFP ...
-
bioRxiv - Synthetic Biology 2022Quote: A plasmid construct containing only the maturation protein and his-tagged coat protein dimer (Addgene # 179156) was transformed into Rosetta2™ (DE3 ...
-
bioRxiv - Bioengineering 2021Quote: ... the Spike protein (Addgene plasmid # 145032) was cloned downstream of the TRE3G promoter ...
-
bioRxiv - Bioengineering 2021Quote: ... We acquired psPAX2 encoding lentiviral packaging proteins and PMD2.G encoding a lentiviral envelop protein from Addgene (plasmid no ...
-
bioRxiv - Molecular Biology 2022Quote: Plasmids pLVX-EF1alpha-SARS-CoV-2-proteins-2xStrep-IRES-Puro proteins are a gift from Nevan Krogan (Addgene)(Gordon ...
-
bioRxiv - Molecular Biology 2020Quote: ... envelope protein plasmid (pMD2.G, Addgene #12259), REV-expressing plasmid (pRSV-Rev ...
-
bioRxiv - Cell Biology 2021Quote: ... and envelope encoding protein (VSVG; Addgene # 8454). Lentiviral particles were collected after 48 hrs of transfection and were used for transducing target cell lines.
-
bioRxiv - Cell Biology 2020Quote: ... or a fluorescent protein (pCDNA3-GFP; Addgene plasmid #74165 or mCherry2-N1 ...
-
bioRxiv - Biochemistry 2023Quote: ... and YFP tagged recombinant proteins (Addgene #173080), genes were inserted between N-terminal 6x His-tag followed by CFP/YFP tag and a TEV protease cleavage site of pNIC28-Bsa4 ...
-
bioRxiv - Biochemistry 2024Quote: ... envelope protein-pCMV-VSV-G (Addgene #8454), packaging plasmid - pCMV-dR8.2 dvpr (Addgene #8455 ...
-
bioRxiv - Cell Biology 2024Quote: ... The fluorescent protein in K-GECO1 (Addgene plasmid #105864 ...