Labshake search
Citations for Addgene :
301 - 350 of 740 citations for Rabbit Anti ALB Recombinant Antibody Clone CA645 ; scFv Fragment since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2022Quote: ... IDT gBlocks encoding fragments of dPspCas13b as in pC0039-CMV-dPspCas13b-GS-ADAR2DD(E488Q) (Addgene# 103849) (25 ...
-
bioRxiv - Immunology 2020Quote: ... and lambda fragments were cloned into AbVec2.0-IGHG1 (Addgene plasmid # 80795; http://n2t.net/addgene:80795; RRID:Addgene_80795), AbVec1.1-IGKC (Addgene plasmid # 80796 ...
-
bioRxiv - Neuroscience 2020Quote: ... DNA fragment encoding human 4R1N full length tau were amplified by PCR using tau cDNA (Addgene). And then the DNA fragment encoding 4R1N tau were inserted into the linearized pHR-mCh-Cry2Olig backbone using In-Fusion Cloning Kit (Takara) ...
-
bioRxiv - Cancer Biology 2022Quote: ... a synthesized double-stranded DNA fragment from IDT and inserted into pENTR1A-GFP-N2 (Addgene # 19364) between EcoRI and NotI ...
-
bioRxiv - Molecular Biology 2020Quote: ... The promoter region of TP53 fragment were cloned into the luciferase vector pGL3-Promoter (Addgene, USA) (TP53-WT-luc) ...
-
Engineering of a fluorescent chemogenetic reporter with tunable color for advanced live-cell imagingbioRxiv - Molecular Biology 2021Quote: ... pCAGGS-H2B-mCerulean was created by removing an SphI fragment from Tol2-CAG::Nucbow (Addgene #158992), and pCAGGS-H2B-EYFP was obtained by removing an AgeI fragment from PB-CAG::CytBow (Addgene #158995) ...
-
bioRxiv - Cell Biology 2021Quote: ... Amplified fragments were cloned to the pPD95.75 vector backbone (gift from Andrew Fire, Addgene plasmid #1494) modified to carry tagRFP ...
-
bioRxiv - Cell Biology 2020Quote: ... the fragment encoding EGFP-SV40 PolyA was PCR amplified from the pcDNA3-hL1 plasmid (Addgene #89411) with primers Fwd ...
-
bioRxiv - Cell Biology 2020Quote: ... the fragment encoding the hL1CAM ORF was PCR amplified from the pcDNA3-hL1 plasmid (Addgene #89411) with primers Fwd ...
-
bioRxiv - Cell Biology 2020Quote: ... the human CAV1 fragment was further moved into a pET28-MBP-TEV plasmid (Addgene No. 69929) described in (37 ...
-
bioRxiv - Genomics 2021Quote: ... DNA fragments were subsequently cloned into the STARR-seq screening vector (pSTARR-seq_human, Addgene plasmid #71509) using the In-Fusion® HD Cloning Kit (Takara/Clonetech) ...
-
bioRxiv - Neuroscience 2020Quote: ... DNA fragment encoding human 4R1N full length tau were amplified by PCR using tau cDNA (Addgene). And then the DNA fragment encoding 4R1N tau were inserted into the linearized pHR-mCh-Cry2Olig backbone using In-Fusion Cloning Kit (Takara) ...
-
bioRxiv - Biophysics 2022Quote: ... This gene fragment was cloned into a linearized vector backbone (original ShTniQ vector from Addgene #135527) containing TwinStrep-SUMO at the N-terminus of S15 using the NEBuilder HiFi assembly protocol (NEB) ...
-
bioRxiv - Microbiology 2022Quote: ... This fragment was then inserted into the pLenti-mCherry-Mango II x 24 plasmid (Addgene #127587) digested with Nhe I and BamH I ...
-
bioRxiv - Cell Biology 2024Quote: ... DNA fragments containing MAP3K1 (MEKK1) or kinase-dead MAP3K1 were excised from pCDNA-MEKK1 plasmids (Addgene #12181 and #12180 ...
-
bioRxiv - Immunology 2024Quote: ... The OVA entry fragment was created using a PCR amplicon from OVA plasmid (Addgene plasmid 64599) with primers containing attB sites (Table 1 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 428-bp PxRdl1 and 441-bp PxRdl2 fragments were cloned into L4440 vector (Plasmid #1654, Addgene) and transformed into HT115 E ...
-
bioRxiv - Microbiology 2023Quote: ... Fragments of the violacein operon were cloned from pBLxVi5 (a gift from Christopher Reisch, Addgene #167516) into pInt_attP1_kanR (26) ...
-
bioRxiv - Bioengineering 2023Quote: ... and cloned as a BamHI/SalI fragment in the pLenti CMV GFP Puro (Addgene plasmid # 17448) to replace an ORF of GFP.
-
bioRxiv - Developmental Biology 2023Quote: ... The three fragments were subcloned into pC-(lox2-attB2-SA-T2A-Gal4-Hsp70)3 (Addgene #62957) by replacing T2A-Gal4 with T2A-GAL4DBD ...
-
bioRxiv - Developmental Biology 2023Quote: ... The three fragments were subcloned into pC-(lox2-attB2-SA-T2A-Gal4-Hsp70)3 (Addgene #62957) by replacing T2A-Gal4 with T2A-VP16 ...
-
bioRxiv - Cell Biology 2023Quote: ... The iLID fragment was originally obtained as a generous gift from the Kuhlman lab (Addgene 60411). TANGO1ShortΔPRD was amplified using 5’-GATCCGCTAGCGCTACCGGTGCCACCATGGACTCAGTACCTGCC-3’ and 5’-ACTACTACCACTACTACCTTCTTCTTGCAGCATTGCC-3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... The iLID fragment was originally obtained as a generous gift from the Kuhlman lab (Addgene 60411). TANGO1Short was amplified using 5’-GATCCGCTAGCGCTACCGGTGCCACCATGGACTCAGTACCTGCC-3’ and 5’-ACTACTACCACTACTACCTGGGCTCTGTTTTAAAGCCTG-3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... Fragments for bacterial expression were cloned into pMW96 plasmid (gift of Tarun Kapoor, Addgene plasmid #178066) which uses the T7 promoter to drive protein expression in Rosseta2
-
bioRxiv - Cell Biology 2023Quote: ... were cloned by PCR as EcoRI–BamHI fragments into the vector pcDNA3.1 mycBioID52 (Addgene plasmid #35700) in frame with BirA ...
-
bioRxiv - Molecular Biology 2024Quote: ... the vector fragment was amplified using PCR from the plasmid p415-GalL-Cas9-CYC1t (Addgene #43804) to keep the GalL promotor and CYC1t terminator but delete the Cas9 sequence which would be replaced by the TAP-tagged protein of interest in the following construction ...
-
bioRxiv - Cell Biology 2024Quote: The eGFP-CCDC32(FL, human) fragment in a pEGFP-C1 vector was purchased from Addgene (#110505) and then mutated to be siRNA resistant ...
-
bioRxiv - Genetics 2024Quote: ... Barcoded fragments were inserted in the SbfI/AgeI site of the pLS-SceI vector (AddGene #13772) and then transformed into 10-beta competent cells (NEB ...
-
bioRxiv - Neuroscience 2024Quote: ... The resulting fragment was purified by electrophoresis and cloned into a pJFRC-MUH plasmid (Addgene #26213) in the XbaI/NotI subcloning site ...
-
bioRxiv - Neuroscience 2024Quote: ... The AAV2_hSyn_SP-Halo-STIM1-deltaK construct was created by amplifying the STIM1-deltaK fragment from Addgene, ref# 18861 ...
-
bioRxiv - Biophysics 2024Quote: ... These fragments were then cloned into a PurExpress meGFP backbone (NVD006, to be deposited on Addgene) by mixing 75 ng of backbone ...
-
bioRxiv - Developmental Biology 2024Quote: ... The resulting fragments were cloned into the Tol2 transgenic vector E1b-eGFP-Tol2(35) (RRID: Addgene_37845) using the In-Fusion Cloning system (Takara Bio) ...
-
bioRxiv - Systems Biology 2022Quote: ... Gateway entry clones pDONR223-EGFR-WT (#81926) were purchased from Addgene. pLEX-305 (#41390 ...
-
bioRxiv - Neuroscience 2020Quote: ... fused after to the GluA2 sequence (Addgene clone #24001, GluA2-pH) by replacing the pHluorin sequence ...
-
bioRxiv - Cancer Biology 2021Quote: ... the two clones were recombined with pLx304 V5-DEST (Addgene #25890) using standard Clonase II LR mix (Thermofisher ...
-
bioRxiv - Systems Biology 2023Quote: ... Entry clones were shuttled into LuTHy (Addgene #113446, #113447, #113448, #113449) and N2H (Addgene #125547 ...
-
bioRxiv - Molecular Biology 2024Quote: ... we note that this clone (like the parental version at Addgene) lacks three amino acids residues (Phe Val Lys ...
-
bioRxiv - Molecular Biology 2024Quote: ... BFP dest clone was a gift from Jacob Corn (Addgene #71825). Cells were then single-cell sorted into a 96-well plate for the top 2.5% fluorescent cells ...
-
bioRxiv - Molecular Biology 2021Quote: ... at this stage CoA-LD555 (Lumidyne) was conjugated to Brn1-ybbR with recombinant SFP synthase (Addgene Plasmid #75015) as previously described (Yin et al. ...
-
bioRxiv - Neuroscience 2020Quote: Recombinant adeno-associated virus carrying the GCaMP6f gene (AAV2/1:hSyn-GCaMP6f) was obtained from Addgene (100837-AAV1) with titer ≥ 1×1012 ...
-
bioRxiv - Molecular Biology 2023Quote: ... A recombinant DNA pcDNA3/Myc-DNMT1 was a gift from Arthur Riggs (Addgene plasmid #36939 Watertown, MA, USA) (Li et al. ...
-
bioRxiv - Developmental Biology 2020Quote: ... Fragments were then inserted into a publicly available destination vector pHPdestmCherry (Addgene #24567, Boy et al. 2010), using the Invitrogen LR Clonase Enzyme Mix (ThermoFisher Scientific) ...
-
bioRxiv - Cell Biology 2022Quote: ... WT and FIP200 KO HeLa cells were cotransfected with the DNA fragment and the PX459 (Addgene #48139)-based plasmid expressing Cas9 and gRNA (GTCTTAGAAGCCGTGAGGTA for the NCOA4 gene ...
-
bioRxiv - Genomics 2020Quote: ... The resulting DNA fragments were cloned into the linearized STARR-seq vector (Addgene #71509, AgeI-SalI digested) using the In-Fusion HD kit (Takara) ...
-
bioRxiv - Neuroscience 2020Quote: ... and inserted this fragment between restriction sites BamHI and HindIII of pAAV-hSyn1-ChR2-EGFP (Addgene #58881). After ...
-
bioRxiv - Microbiology 2020Quote: ... the EF1a promoter driven rtTA fragment from PB-CA-rtTA Adv (gift from Andras Nagy, Addgene # 20910), and an in-frame Hygromycin selection marker connected by 2A peptide sequence ...
-
bioRxiv - Molecular Biology 2022Quote: ... The resulting DNA fragment containing two MpU6promoter-gRNA cassettes was transferred into pMpGE010 (cat. no. 71536, Addgene) (Sugano et al. ...
-
bioRxiv - Genetics 2022Quote: ... The resulting 100-bp fragment was assembled into an AflII-linearized gRNA empty vector (Addgene, ID#41824) using the Infusion assembly protocol (TaKaRa Bio) ...
-
bioRxiv - Genomics 2021Quote: ... The amplified fragments were then inserted into SbfI/AgeI site of the pLS-SceI vector (Addgene, 137725) using NEBuilder HiFi DNA Assembly mix (NEB) ...
-
Engineering of a fluorescent chemogenetic reporter with tunable color for advanced live-cell imagingbioRxiv - Molecular Biology 2021Quote: ... and pCAGGS-H2B-EYFP was obtained by removing an AgeI fragment from PB-CAG::CytBow (Addgene #158995). Construction details ...