Labshake search
Citations for Addgene :
251 - 300 of 740 citations for Rabbit Anti ALB Recombinant Antibody Clone CA645 ; scFv Fragment since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... GCaMP6s and P2A gene fragments were obtained from pGP-CMV-GCaMP6s-WPRE (Addgene: #40753) and pAAV-hSyn1-GCaMP6s-P2A-nls-dTomato (Addgene ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV.Dlx.DIO.TVA was constructed by inserting the hDlx promoter fragment from pAAV-VTKD2 (Addgene #170847) into the backbone pAAV-EF1a-flex-TVA (Addgene #69618) ...
-
bioRxiv - Neuroscience 2024Quote: ... The fragment was inserted into pAAV-hSyn-DIO-EGFP (plasmid from Addgene, #50457, RRID:Addgene_50457) in place of EGFP to produce the plasmid construct (AAV-hSyn-DIO- mGLP1R-HA) ...
-
bioRxiv - Neuroscience 2024Quote: ... The fragment was inserted into pAAV-hSyn-DIO-EGFP (plasmid from Addgene, #50457, RRID:Addgene_50457) in place of EGFP to produce the plasmid construct (AAV-hSyn-DIO- mGLP1R-HA) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The restriction fragment was ligated into pAFW-Ago2 (Addgene 50554, gift from Yukihide Tomari) (52) ...
-
bioRxiv - Cell Biology 2021Quote: ... The recombinant plasmid along with a pBabe-puro construct (Addgene, 1764; deposited by Dr. Hartmut Land) expressing mouse ATG16L1 variants was transfected into HEK293 ATG13_KO GFP-LC3B cells via Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Neuroscience 2023Quote: ... an H2B-GCaMP6s middle entry clone was prepapred from Addgene plasmid #59530 and subsequently recombined with p5E_QUAS (Addgene ...
-
bioRxiv - Biophysics 2023Quote: ... The cDNA clone for Sec61β (#49155) was obtained from Addgene, whereas the cDNA clones for Atg16L1 (BC013411 ...
-
bioRxiv - Physiology 2024Quote: UAS-Gαiact was generated from the Gαi cDNA clone (Addgene) LD22201 ...
-
bioRxiv - Biochemistry 2022Quote: ... KRAS4A and KRAS4B entry clones (Addgene plasmids 83166 and 83129) and ARAF ...
-
bioRxiv - Neuroscience 2023Quote: ... For the transfection with human Pdhk1 clone (hPdhk1; Addgene: 20564). Pre-OLs after partial differentiation for 4 days from the OPCs ...
-
bioRxiv - Genetics 2024Quote: ... To clone the two sgRNAs into lentiCRISPRv2 vector (Addgene, #52961), we amplified the sgRNA scaffold and mouse U6 promoter using two oligos containing the designed sgRNA sequences ...
-
bioRxiv - Genetics 2021Quote: ... These DNA fragments were subsequently assembled into a XbaI/AscI-linearized w+attB plasmid (Addgene, Watertown ...
-
bioRxiv - Neuroscience 2021Quote: ... The amplified fragment was subsequently digested and cloned into the EcoRI site within pCAGIG (Addgene plasmid #11159 ...
-
bioRxiv - Cell Biology 2021Quote: ... Gene fragments were ligated into either an mCherry or EGFP pBABE-based vector (Addgene #44432). sgRNA constructs for individual inducible knockout cell lines were generated by primer annealing and ligation into sgOPTI (56 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Amplified fragments were digested with XhoI and NotI and cloned into pCAGIG plasmid (Addgene, 11159) which was linearized using the same restriction enzymes to generate pCAGIG-hA3A-BE3.
-
bioRxiv - Cancer Biology 2020Quote: ... full length DVL2 and DVL3 PCR-fragments were amplified from 3X-FLAG-DVL2 (Addgene #24802) and XE251-pcDNA3.1 (zeo ...
-
bioRxiv - Cell Biology 2022Quote: ... of two PCR based fragments generated by amplifying the pN-PITCh-GFP (Addgene plasmid #127888) vector backbone using primers 5’ caaacacgtacgcgtacgatgctctagaatg and 5’ tgctatgtaacgcggaactccatatatggg and the Rac1 sequence flanked Puro-GFP cassette from pN-PITCh-GFP using primers 5’ccgcgttacatagcatcgtacgcgtacgtgtttggGGCCCAGCGAGCGGCCCTGAtgaccgagtacaagcccacg and 5’cattctagagcatcgtacgcgtacgtgtttgggACCACACACTTGATGGCCTGCAtcttgtacagctcgtccatgccgag.
-
bioRxiv - Microbiology 2022Quote: pEMG-Tel (pEMGT) was constructed by cloning a DNA fragment from pMo130-TelR (Addgene, #50799) (bearing the Tel resistance marker ...
-
bioRxiv - Developmental Biology 2020Quote: ... 2A-mCherry-loxP-Neo-loxP fragment was cloned from Nanog-2A-mCherry plasmid (Addgene #59995). The different fragments were then cloned to pUC19 plasmid to make the complete donor plasmids for both knockin experiments ...
-
bioRxiv - Neuroscience 2020Quote: ... Amplified fragments were cloned tandemly into MluI-digested pAAV EF1α DIO mCherry (Addgene plasmid 20299) by Gibson assembly method ...
-
bioRxiv - Neuroscience 2020Quote: ... Modified TALE constructs were created using PCR fragments amplified from pAAV-CW3SL-EGFP (Addgene # 61463), a gift from Bong-Kiun Kaang (Choi et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... the TurboID fragment was amplified by PCR from the 3xHA-TurboID-NLS_pCDNA3 plasmid (Addgene #107171) with primers 8 and 9 ...
-
bioRxiv - Molecular Biology 2021Quote: ... CDS fragments of interest were cloned into the entry Gal4 tethering vector (Addgene 128013-128014) and the resulting plasmids were electroporated into OSCs ...
-
bioRxiv - Cell Biology 2023Quote: ... Boston University Medical School) with EGFP-Tnrc6a DNA fragment from pT7-EGFP-Tnrc6A (Addgene #25035) plasmid ...
-
bioRxiv - Biophysics 2023Quote: Human BAF57 and BAF155 gene fragments were amplified from plasmids pBS-hBAF57 (Addgene ID #17877) and pBS-hBAF155 (Addgene ID #17876) ...
-
bioRxiv - Bioengineering 2023Quote: ... containing the primary or a fragment of the primary miR sequences were obtained from Addgene as stab cultures ...
-
bioRxiv - Systems Biology 2023Quote: ... The BsmBI-flanked spacer was then replaced by a fragment amplified from pJR98 (Addgene #140096), carrying the constant region of the first sgRNA and the promoter for the second one ...
-
bioRxiv - Developmental Biology 2023Quote: ... 2A-mCherry-loxP-Neo-loxP fragment was cloned from Nanog-2A-mCherry plasmid (Addgene # 59995). The different fragments were then cloned to a modified pUC19 plasmid with additional restriction sites inserted ...
-
bioRxiv - Cell Biology 2024Quote: ... The Cry2 fragment was amplified by PCR from the plasmid pHR-mCh-Cry2WT (Addgene, #101221) with primer set #2 (Supplementary Table 1 ...
-
bioRxiv - Cell Biology 2024Quote: Human Pcdhga9 mutants were generated by cloning PCR-amplified fragments into pBob-GFP vector (Addgene). For GFP-tagged constructs ...
-
bioRxiv - Neuroscience 2024Quote: ... the fragments were cloned into an pJFRC7-20XUAS-IVS-mCD8::GFP vector (Addgene plasmid # 26220), replacing the mCD8::GFP insert via restriction enzyme digest (XhoI ...
-
bioRxiv - Developmental Biology 2024Quote: ... 5’-AAACCCTTATTCGTACGTGGCT-3’) foxl2l#1 and foxl2l#2 fragments were cloned into pT7-gRNA (Addgene) through one-step digestion and ligation respectively ...
-
bioRxiv - Genetics 2024Quote: ... a fragment cleaved from EF1a Puro Telo v1 (gift from Jason Sheltzer; Addgene plasmid #195138), which encodes a puromycin resistance cassette fused to a telomeric sequence ...
-
bioRxiv - Genomics 2024Quote: ... The fragment was subsequently cloned by DNA ligation in the donor vector pEN366 (Addgene #156432), after removal of the TRE3G-CTCF-mRuby2 fragment by digestion using the same restriction enzymes ...
-
bioRxiv - Cell Biology 2024Quote: ... The Cry2 fragment was amplified by PCR from the plasmid pHR-mCh-Cry2WT (Addgene, #101221) with primer set #2 (Supplementary Table 1 ...
-
bioRxiv - Neuroscience 2023Quote: ... gene fragments of GCaMP6s and P2A were obtained from pGP-CMV-GCaMP6s-WPRE (Addgene: #40753) and pAAV-hSyn1-GCaMP6s-P2A-nls-dTomato (Addgene ...
-
bioRxiv - Molecular Biology 2023Quote: ... the DNA fragment encoding APEX2 was PCR amplified from pcDNA5/FRT/TO APEX2-GFP (Addgene) and fused to the N-terminus of DDX3X using fusion PCR ...
-
bioRxiv - Cell Biology 2024Quote: ... FLAG-APEX2 fragment was amplified form pcDNA3 APEX2-NES (Addgene, 49386 (Lam et al., 2015)) ...
-
bioRxiv - Biophysics 2023Quote: ... a linear DNA fragment was first amplified by PCR from plasmid pCDW114 (16, Addgene #70061), using primers 5′-GAAGGTCTCCAGCCGTACCAACCAGCGGCTTATC-3′ and 5′-CCGGG TCTCACCATACCCGCTGTCTGAGATTACG-3′ ...
-
bioRxiv - Cell Biology 2023Quote: ... the 3xFLAG-6xHis gene fragment (IDT) was subcloned into the AAVS1_3xFLAG-2xStrep plasmid (Addgene, 68375) at the NcoI/BstBI sites (“AAVS1_3xFLAG-6xHis”) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Another fragment containing PBac{3XP3-DsRed} was amplified (Addgene 80820, gift from Kate O’Connor-Giles) and inserted in between POLQ homology arms in pHD-w+ ...
-
bioRxiv - Biochemistry 2020Quote: Recombinant wild-type and mutant SpCas9 (1-1,368) possessing a C-terminal decahistidine tag (Addgene, no. 62731) was expressed and purified as described previously (35) ...
-
bioRxiv - Genetics 2022Quote: Recombinant AAV-PHP.eB [13] was packaged in AAVpro 293T cells by co-transfection of PHP.eB (Addgene, 103005), pHelper (Agilent ...
-
bioRxiv - Microbiology 2024Quote: ... Recombinant lentivirus was produced by co-transfecting sub-confluent HEK293T cells with the pMD2G (Addgene, Massachusetts, USA), psPAX2 (Addgene ...
-
bioRxiv - Cell Biology 2020Quote: ... V5 and AP fragments were amplified from GFP-V5-P180 (Hung et al., 2017; Addgene # 92150) and TOM20-V5-FKBP-split-AP (Han et al. ...
-
bioRxiv - Microbiology 2021Quote: ... The final 463 bp fragment was ligated with the pcDNA3.1(+)circ RNA Mini Vector (Addgene, 60648) digested with KpnI-HF and BamHI-HF ...
-
bioRxiv - Cell Biology 2022Quote: ... and TAX1BP1 KO HeLa cells were cotransfected with the DNA fragment and the PX459 (Addgene #48139)-based plasmid expressing Cas9 and gRNA (GGGGCCACTAGGGACAGGAT) ...
-
bioRxiv - Developmental Biology 2020Quote: ... The fragment was inserted into the BsaI site of pMpGE_En03 (Cat. No. 71535, Addgene, Cambridge, MA) to yield pMpGE_En03-MpKNOX1ge ...
-
bioRxiv - Genetics 2021Quote: ... and the amplified product was assembled to 9083 bp fragment of pHACK-Gal4>QF2 (Addgene #104873) that was digested with AvrII and SalI ...