Labshake search
Citations for Addgene :
301 - 350 of 397 citations for Octreotide acetate impurity C since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... GST-SH2 SHC1 (#46486)13 and GST-SH2 (encompassing both the N- and C-terminus) SHP2 (#67575)14 were purchased from Addgene. Phospho-Y222 antibody was developed using peptide CDQRGQSI-pY222-STSFPQP ...
-
bioRxiv - Genetics 2024Quote: ... The following adenine base editor expression plasmids were used for mutation A-to-G to T-to-C transitions: ABE7.10 SpCas9-WT (Addgene # 102919), ABE7.10 SpCas9-VRQR (Addgene #119811) ...
-
bioRxiv - Molecular Biology 2020Quote: ... A C-terminal Strep tag on ORF24-NTD was added by inverse PCR to generate p6H-SUMO3-ORF24-NTD-Strep (Addgene #138467).
-
bioRxiv - Molecular Biology 2020Quote: ... Full-length UL87 was PCR amplified from HCMV Towne BAC DNA with primers to introduced EcoRI and XhoI sites and cloned into pcDNA4/TO-2xStrep (C-terminal tag) using T4 DNA ligase (Addgene #138434). Full-length mu24 was PCR amplified from MHV68-infected 3T3 cell cDNA with primers to introduce BamHI and NotI sites and cloned into pcDNA4/TO-2xStrep (C-terminal tag ...
-
bioRxiv - Cell Biology 2020Quote: ... obtained from Dharmacon) into pUAST vectors containing a C-terminal Venus open reading frame (Wang et. al, 2012, Addgene plasmid 35204). Transgenes were sequenced and then injected into embryos containing an attP8 site on the X chromosome (BDSC stock #32233 ...
-
bioRxiv - Cell Biology 2020Quote: ... containing human ATF6 cDNA fused to mCerulean on the C-terminal side of ATF6 was generated by amplifying ATF6 ORF from pEGFP-ATF6 (Addgene #32955) by PCR using the following primers ...
-
bioRxiv - Genetics 2021Quote: ... or the catalytic domain (CD) of mouse Dnmt3a and the C-terminal part of mouse Dnmt3L (3a3L) (amplified from pET28-Dnmt3a3L-sc27 (Addgene #71827)) and cloned in PiggyBac plasmids under control of the TRE3G promoter ...
-
bioRxiv - Molecular Biology 2020Quote: ... We built plasmids by Gibson assembly for constitutive expression of histones and K27M mutant histones tagged at their C-termini with 2XFLAG epitope tags using the Copia promoter from the plasmid pCoPURO (Addgene 17533), and Drosophila H3 and H3.3 histones from previously published constructs (Ahmad & Henikoff ...
-
bioRxiv - Microbiology 2021Quote: VSV-G–pseudotyped lentiviruses expressing ACE2 orthologs tagged with FLAG at the C-terminus were produced by transient co-transfection of the third-generation packaging plasmids pMD2G (Addgene #12259) and psPAX2 (Addgene
-
bioRxiv - Biochemistry 2020Quote: ... Monobody HA4 or OptoMB variants were PCR amplified and Gibson-assembled from bacterial plasmids (described above) into a pHR vector with a C-terminal irFP fusion (Addgene #111510). The SH2 domain was amplified from EZ-L664 using PCR ...
-
bioRxiv - Biophysics 2021Quote: ... Fractions containing the target proteins were dialyzed against PBS (pH 7.4) and the His6-SUMO-tag was removed by enzymatic cleavage using human SENP1 protease at 4°C overnight (Addgene #16356) (51) ...
-
bioRxiv - Cell Biology 2021Quote: ... codon optimized coding sequences with a C-terminal HA epitope tag were synthesized by IDT and cloned into a pCW57.1 (Addgene plasmid #41393) derived lentiviral vector with a blasticidin resistance gene (replacing the original puromycin resistance gene) ...
-
bioRxiv - Biochemistry 2021Quote: ... The PCR products were used as templates for final PCR using 5’ GGGGTACCGAA GTAAAACTTTAACTTCA G 3’ and 5’ CCGCTCGAGCTAATGATGATGATGATGATGC AATCCCCGAGACTTGTA C 3’ primer pair (KpnI and XhoI sites are underlined respectively) and cloned into pIB3 vector (cat # 25452, Addgene, USA). Similar strategy was used for PGAPDH-PEPCKDPRPEPCKMyc construct generation ...
-
bioRxiv - Microbiology 2020Quote: ... pseudotyped lentiviruses expressing ACE2 orthologs tagged with FLAG at the C-terminus were produced by transient co-transfection of the third-generation packaging plasmids pMD2G (Addgene #12259) and psPAX2 (Addgene #12260 ...
-
bioRxiv - Cell Biology 2021Quote: Plasmids for the FRET-aggregation reporters were generated by subcloning full length human α-synuclein PCR-amplified from pCAGGS-aSyn-CFP (a gift from Robert Edwards and Ken Nakamura)39 to the C-terminal Clover2 or mRuby2 into the lentiviral expression vector pMK1200 (Addgene #84219)21 under the control of the constitutive EF1A promoter ...
-
bioRxiv - Biochemistry 2022Quote: ... DNA encoding peptides derived from the C-terminal last 10 residues of the norovirus and cellular proteins were cloned into the pET-His-GST vector (Addgene:29655) with an N-terminal GST tag ...
-
bioRxiv - Cell Biology 2022Quote: ... The mammalian expression plasmid for Ism1 with C-terminal myc-6xhis tag plasmid for recombinant Ism1 protein production was from Addgene (#173046).
-
bioRxiv - Cancer Biology 2022Quote: ... Constitutively active mouse STAT3 (STAT3-CA) plasmid Stat3-C Flag pRc/CMV was a gift from Jim Darnell (Addgene plasmid 8722).
-
bioRxiv - Molecular Biology 2020Quote: ... Full-length BcRF1 was PCR amplified from pcDNA4/TO-BcRF1-3xFLAG (19) and cloned into the BamHI and XhoI sites of pcDNA4/TO-2xStrep (C-terminal tag) using InFusion cloning (Addgene #138436). Mutations of the RLLLG motif in UL87 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Full-length mu24 was PCR amplified from MHV68-infected 3T3 cell cDNA with primers to introduce BamHI and NotI sites and cloned into pcDNA4/TO-2xStrep (C-terminal tag) using T4 DNA ligase (Addgene #138435). Full-length BcRF1 was PCR amplified from pcDNA4/TO-BcRF1-3xFLAG (19 ...
-
bioRxiv - Microbiology 2021Quote: ... pseudotyped lentiviruses expressing ACE2 orthologs tagged with FLAG at the C-terminus were produced by transient co-transfection of the third-generation packaging plasmids pMD2G (Addgene #12259) and psPAX2 (Addgene #12260 ...
-
bioRxiv - Cell Biology 2021Quote: Fragments of Cnn-C-N and Cnn-T-N used in co-IP experiments were amplified from the pDONR-Cnn-C and pDONR-Cnn-T vectors described above by PCR and inserted into a pDEST-HisMBP (Addgene, #11085) vector by Gateway cloning (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2021Quote: ... pseudotyped lentiviruses expressing ACE2 orthologs tagged with FLAG at the C-terminus were produced by transient co-transfection of the third-generation packaging plasmids pMD2G (Addgene #12259) and psPAX2 (Addgene #12260 ...
-
bioRxiv - Cell Biology 2020Quote: hCIB2 was subcloned into pET21a (histidine tag on the C-terminus; hCIB2-6xHis) and GST-Rheb in pGEX-4T-2 (Addgene #15889), transformed in Bl2 (DE3 ...
-
bioRxiv - Microbiology 2021Quote: ... pseudotyped lentiviruses expressing ACE2 orthologs tagged with FLAG at the C-terminus were produced by transient co-transfection of the third-generation packaging plasmids pMD2G (Addgene #12259) and psPAX2 (Addgene #12260 ...
-
bioRxiv - Immunology 2020Quote: ... Selected gRNAs shown in Figure 1 B and C were synthesized by IDT and cloned into eSpCas9(1.1) (a gift from Feng Zhang Addgene plasmid # 71814). The LC donor DNA of HuGL18 was designed as follows from 5′ to 3′ ...
-
bioRxiv - Biophysics 2020Quote: ... The PCR product containing codon optimized nsp12 was cloned into the modified pFastBac vector 438-C (a gift from S. Gradia, UC Berkeley, Addgene: 55220) via LIC ...
-
bioRxiv - Genetics 2023Quote: ... and assembled as a c-terminal FRB fusion gene and replacing the spCas9-mSA cassette of the PCS2+ Cas9-mSA plasmid (Addgene 103882) (Gu et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cas9-mRNA was in vitro transcribed overnight at 20°C from 400-500 ng XbaI-linearized pT3TS-nCas9n (Addgene, plasmid #46757) using the mMessage mMachine T3 Kit (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... The plasmid MCherry-Actin-C-18 was a gift from Michael Davidson (Addgene plasmid 54967; http://n2t.net/addgene : 54967; RRID : Addgene 54967 [63]).
-
bioRxiv - Molecular Biology 2023Quote: ... forward and reverse primer pairs were annealed and then cloned into the BsmBI restriction site in the pLV hU6-sgRNA hUbC-dCas9-KRAB-T2a-Puro vector (gift from C. Gersbach, Addgene #71236). HCT116 cell lines constitutively expressing dCas9-KRAB and appropriate targeting gRNA were generated as described in (Thakore et al. ...
-
bioRxiv - Molecular Biology 2022Quote: ... The fragments are then cloned into a mammalian expression vector containing Flag and mEGFP (N- or C-terminal) (modified from Addgene #32104) using NEBuilder HiFi DNA Assembly kit (E2611) ...
-
bioRxiv - Developmental Biology 2024Quote: ... sgRNA oligos targeting the C-terminal region of target genes were cloned into the pX330 Cas9/sgRNA expression plasmid (Addgene 42230). For generation of the reporter line ...
-
bioRxiv - Physiology 2024Quote: ... Pparg1 or Pparg2 in NIH-3T3 cells was performed by transfecting pcDNA3.1(-) rat C/EBP alpha (#12550, Addgene, Watertown, MA, USA), pcDNA-mC/EBPb (#49198 ...
-
bioRxiv - Cell Biology 2023Quote: ... 25 μg of pT/Caggs-NRASV12 or pT/Caggs-NRASV12/D38A and 5 μg of PT2/c-Luc//PGK-SB-13 (Addgene, 20207) were suspended in 0.9% saline solution at a final volume of 10% of the body weight and injected via the tail vein within 8 seconds ...
-
bioRxiv - Cancer Biology 2024Quote: ... plasmids were obtained from cloning the c-myc sequence or a MTS sequence respectively into the pEIGW roGFP2-ORP1 vector (Addgene #64993). For lentivirus production ...
-
bioRxiv - Immunology 2023Quote: ... was amplified and flanked with an EGFP tag at the N-terminus and an MYC epitope at the C-terminus before the stop codon followed by cloning into EcoRV-linearized pLenti-CMV-Puro-DEST plasmid (Addgene #17452) using Gibson Assembly.
-
bioRxiv - Biophysics 2023Quote: ... UblBilA was cloned into a vector encoding a C-terminal GFP tag (UC Berkeley Macrolab vector H6-msfGFP, Addgene ID 29725) and purified as above ...
-
bioRxiv - Biochemistry 2022Quote: ... For expression of recombinant drosophila c-Src isoform 42A (Src42A, UniProtKB Q9V9J3) we used a pET-His10-Src42A plasmid (Addgene #126674) codifying a full-length drosophila isoform (aa 1-517 ...
-
bioRxiv - Developmental Biology 2022Quote: ... 35 μl of hot glycerol was cooled to 4°C then 35 μl of the primer mixture and 25 μl of Tn5 (Addgene #112112) was added and mixed and held at 1 hr at RT with gentle pipet mixing every 15 min ...
-
bioRxiv - Biochemistry 2023Quote: ... The codon optimized AOX with a C-terminal HA tag synthesized by IDT was cloned into pLv-EF1a-IRES-puro (Addgene 85132), pAAV.TBG.PI.eGFP.WPRE.bGH (Addgene 105535) ...
-
bioRxiv - Cancer Biology 2022Quote: ... NLS-catalase and TET-ON NLS-catalase plasmids were obtained from cloning the catalase and c-myc sequences into a hygromycin-containing backbone vector (Addgene, #17446). H3.1 C96S-Flag (blasticidin as selection mark ...
-
bioRxiv - Cancer Biology 2022Quote: ... NLS-Orp1-roGFP2 and mito-Orp1-roGFP2 (puromycin as selection mark) were obtained from cloning the c-myc sequence or a MTS sequence respectively into the Orp1-roGFP2 vector (Addgene, #64993). NLS-DAO plasmid (geneticin as selection mark ...
-
bioRxiv - Biochemistry 2024Quote: ... with SNAP-tag proteins fused in-between Aga2p-HA-tag (N-terminal) and cMyc-tag (C-terminal) or a pJYDNg vector (Addgene, #162452) with a C-terminal fusion to Aga2p-HA-tag-cMyc-tag-eUnaG2 was used ...
-
bioRxiv - Developmental Biology 2024Quote: ... pUltra-EGFP-FL-NRL was produced by amplification of the FL-NRL coding sequence from pCDNA4-C-EF1α-FL-NRL and inserting into BamHI digested pUltra-EGFP (Addgene 24129) (primers #12 ...
-
bioRxiv - Cell Biology 2024Quote: ... 5’-CAC CGG GAG CAT TTG CGC TTG CGG C-3’ and 5’-AAA CGC CGC AAG CGC AAA TGC TCC C-3’ comprising the VPS35 guide RNA were annealed and inserted into the pLentiCRISPRv2 (Addgene, 49535) vector ...
-
bioRxiv - Cell Biology 2024Quote: ... 5’-CAC CGT TCA TAC CTC AAG CGG ACA T-3’ and 5’-AAA CAT GTC CGC TTG AGG TAT GAA C-3’ comprising the VPS26 guide RNA were annealed and introduced into pLentiCRISPRv2 hygro (Addgene, 98291). Lentivirus was produced as described above and transduced into VPS35 KO cells ...
-
bioRxiv - Biochemistry 2024Quote: ... BubA was cloned into a vector encoding a C-terminal GFP tag (UC Berkeley Macrolab vector H6-msfGFP, Addgene ID 29725) and purified as above ...
-
bioRxiv - Molecular Biology 2020Quote: ... and UL87 were PCR amplified from these plasmids and cloned into BamHI/XhoI-cut pcDNA4/TO-2xStrep (C-terminal tag) using InFusion cloning (Addgene #138441-138452). Chimeras of the minimal domain (NTD ...
-
bioRxiv - Neuroscience 2021Quote: ... a PCR-amplified ubiquitin C promoter (UBC)-blasticidin (Bla) cassette from vector pLV-TRET-hNgn1-UBC-Bla (46)(gift from Ron Weiss, Addgene plasmid, 61473) was further added to both vector assemblies resulting in reporter plasmids PB-hRHO-DsRed-WPRE-BGH-pA-UBC-Bla and PB-mCAR-EGFP-WPRE-BGH-pA-UBC-Bla ...