Labshake search
Citations for Addgene :
251 - 300 of 397 citations for Octreotide acetate impurity C since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2021Quote: ... The pET C-terminal TEV His6 cloning vector with BioBrick polycistronic restriction sites (9Bc) was a gift from Scott Gradia (Addgene plasmid #48285 ...
-
bioRxiv - Biophysics 2022Quote: ... The plasmid MCherry-Actin-C-18 was a gift from Michael Davidson (Addgene plasmid 54967; http://n2t.net/addgene : 54967; RRID : Addgene_54967 [51]).
-
bioRxiv - Cell Biology 2022Quote: ... 5’-GGG GGG GGC GGA ATT CTC AGT CTA TCT TTT CTT TCT GGA CCA GTC TGG GAG C-3’ and pmScarlet-C1 (gift from Dorus Gadella; Addgene plasmid # 85042 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The expression vectors of the full-length SARS-CoV-2 spike and the human serine protease TMPRSS2 with a C-terminal C9-tag (TETSQVAPA) were acquired from AddGene (Summit Pharmaceutical International ...
-
bioRxiv - Biochemistry 2020Quote: ... To construct PTP1BPS* and PTP1BPS**, we amplified C-terminal regions of PTP1B (residues 299-405 and 299-435, respectively) from pGEX-2T-PTP1B (Addgene) and used Gibson assembly to join them to the C-terminus of PTP1BPS (50°C for 1 hr ...
-
bioRxiv - Neuroscience 2020Quote: ... The constructs were subcloned using restriction digestion into the pHL-sec vector containing a C-terminal 6xHis-tag (Addgene # 99845). Restriction sites for subcloning were introduced by PCR at the 5’ and 3’ ends of scFv-Clasp heavy and light chains (light chain ...
-
bioRxiv - Biophysics 2021Quote: The construct for the adaptor protein mTurquoise-SRC-N-18 (SRC with mTurquoise fused to its C-terminus via a linker) was a gift from Michael Davidson (Addgene plasmid # 55560 ...
-
bioRxiv - Bioengineering 2020Quote: Synthetic thermal switches were produced as gene blocks by IDT and cloned into the Lego-C backbone (Addgene plasmid #27348). The core promoters were truncated immediately upstream of their previously described TATA boxes at their 5’-termini and at their translational start site on their 3’-termini 76-78 ...
-
bioRxiv - Cell Biology 2021Quote: pTRIP-SFFV-EGFP-NLS and the coding sequences of mEmerald-Lamin A/C and mEmerald-Lamin B1 were from Addgene. pLVX-N-GFP was a kind gift from Prof ...
-
bioRxiv - Biochemistry 2022Quote: ... with an initial Met and a cleavable C- terminal TEV 6x-His tag was a gift from Ginkgo Bioworks (Addgene plasmid 145611 ...
-
bioRxiv - Biochemistry 2022Quote: ... with an initial Met and a cleavable C-terminal TEV 6x-His tag) was a gift from Ginkgo Bioworks (Addgene plasmid 145584 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and WPRE were cloned into the EcoRI site of pCCL-c-MNDU3-X (gift from Donald Kohn, Addgene plasmid #81071) or pMYs (Cell Biolabs ...
-
bioRxiv - Neuroscience 2021Quote: The guides were inserted into a deadCas9-KRAB-T2A-GFP lentiviral backbone containing both the guide RNA under the U6 promoter and dead-Cas9-KRAB and GFP under the Ubiquitin C promoter (pLV hU6-sgRNA hUbC-dCas9-KRAB-T2a-GFP was a gift from Charles Gersbach (Addgene plasmid #71237 ...
-
bioRxiv - Cancer Biology 2020Quote: ... SK-N-BE(2)-C cells were transduced with lentiviral constructs for stable expression of the different tested RRM2 promotor targeting sgRNAs (Addgene) (MP-I-1142 sg86RRM2 ...
-
bioRxiv - Microbiology 2022Quote: ... mEmerald-CLIP170-N-18 and mCherry-ATG3-C-18 were gifts from Michael Davidson (Addgene cat. 54967, 54044 and 54993) [63] ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and LY6C1 (NM_010741.3) were separately cloned into an expression vector backbone with a C-terminal Fc-tag (Addgene plasmid #115773) using Xbal/EcoRV ...
-
bioRxiv - Microbiology 2020Quote: ... or human ACE2 ectodomain (containing a C-terminal His tag) were made according to the E and F sections of the pLKO.1 Protocol from Addgene (http://www.addgene.org/protocols/plko/) ...
-
bioRxiv - Cell Biology 2020Quote: ... of a TubB1 sequence fragment synthesised as a gBlock by Integrated DNA Technologies (IDT) and a C-terminal mApple empty backbone (mApple-C1 was a gift from Michael Davidson (Addgene plasmid # 54631 ...
-
bioRxiv - Immunology 2021Quote: ... were co-electroporated with 5 µg of either pCB92-C*05 or pEx-CAG-KIR2DL1 and 5 µg of pPhiC31o (Addgene) using the Neon transfection system (Thermo Fisher ...
-
bioRxiv - Immunology 2021Quote: ... Full length FOXN1 cDNA without a stop codon was cloned into vector backbones positioning at its C-terminus either a flag (pCSF107mT-GATEWAY-3’-FLAG, Addgene), myc (pCSF107mT-GATEWAY-3’-Myc tag ...
-
bioRxiv - Immunology 2021Quote: ... The lentiviral HLA-C expression plasmids were co-transfected with the vesicular stomatitis virus-G envelope plasmid pMD2.G (Addgene) and packaging plasmid psPAX2 (Addgene) ...
-
bioRxiv - Neuroscience 2020Quote: ... membrane-trafficking optimized variant was generated by fusing an additional trafficking signal from the potassium channel Kv2.112 to the C-terminus of Chrimson (pAAV-hSyn-somBiPOLES-mCerulean; Addgene #154945). For expression in GABAergic neurons ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The GFP fragment was amplified and C-terminally Flag-tagged using primers GFP_IndOE_F & R and the construct pT2-CAG-fGFP (Addgene plasmid #108714) as template ...
-
bioRxiv - Biochemistry 2021Quote: ... Vector pREXNH3CA used to clone EfrCD in frame with a C-terminal Avi-tag was constructed from pREXNH3 (Addgene #47079) by PCR amplification with 5’ phosphorylated primers pREXNH3(newAvi_5’P)_FW (5’-aga aaa tcg aat ggc acg aaT AAT AAC TAG AGA GCT CAA GCT TTC TTT GA ...
-
bioRxiv - Synthetic Biology 2021Quote: ... or Omphalotin A (OphA) genes with C-terminal His-tags were cloned into the UTR1-T7RNAP-T500 plasmid backbone (Catalog No. 67739, Addgene). The T7 Max promoter was further cloned into these plasmids for downstream experiments ...
-
bioRxiv - Developmental Biology 2022Quote: ... or synthesized (NLS and N1ICD the fragment of [ENSMUST00000028288.5] encoding the C-terminal 789 AA of the Notch1 protein) and cloned with sequence encoding an N- or C-terminal eGFP into a modified version of pLKO.3G (Addgene, Cat #14748 ...
-
bioRxiv - Cell Biology 2022Quote: ... we added a signal peptide at the N-terminus of Breg and a 6×His tag at its C-terminus using pHL-sec vector (Addgene)39 ...
-
bioRxiv - Microbiology 2022Quote: ... C-terminal FLAG-tagged TMPRSS2 orthologues and the human ΔHDS mutant were ligated into the lentiviral pWPI-BLR vector (Addgene) via restriction digestion or using HiFi Builder (NEB) ...
-
bioRxiv - Pathology 2024Quote: ... (WT and variants) with a mTurquoise (mTq2) tag on the C-terminus were cloned into a pSBtet-pur vector (Addgene) using SfiI sites ...
-
bioRxiv - Cell Biology 2023Quote: ... Sequences encoding N-KSR or C-KSR were subcloned into SfiI sites of pSBbi-pur-H-2Kb (# 111623, Addgene, USA) replacing an existing H-2kb fragment ...
-
bioRxiv - Biophysics 2023Quote: ... Plasmid DNA for expressing CRY2olig tagged with mCherry at its C-terminus was obtained from Addgene (#60032; Watertown, MA, USA). The plasmid (1.0 µg/dish ...
-
bioRxiv - Biochemistry 2023Quote: Restriction-free cloning 30 was used to generate the constructs of MglA-link-MglB with C-terminal hexahistidine tag in pHis17-KanR (mglA-link-mglB-H6, refer Addgene plasmid #78201 for vector backbone ...
-
bioRxiv - Bioengineering 2023Quote: The pSECRETS-C plasmids containing desired on-target sequences were constructed via HiFi assembly into the p11.LacY.wtx1 plasmid (Addgene #69056), which was double digested with XbaI and SphI ...
-
bioRxiv - Cell Biology 2023Quote: The human sFLT1-HA plasmid construct created through Gibson cloning of human sFLT1 cDNA into a pcDNA3.1 vector containing a C-terminal HA tag (pcDNA3-ALK2-HA, Addgene 80870). Sequencing validation was performed through Genewiz ...
-
bioRxiv - Genetics 2023Quote: ... Forward and reverse oligos (CACCGCTGCTGCTGCTGCTGCTGGA and AAACTCCAGCAGCAGCAGCAGC) (IDT) for gRNA 2 were cloned into the BSmBI site of pCbh_v5 AAV-CBE C-terminal (Addgene, # 137176) and pCbh_v5 AAV-CBE N-terminal (Addgene ...
-
bioRxiv - Developmental Biology 2023Quote: ... A sgRNA targeting the SYNGAP1 c.1507C site was cloned into pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene plasmid #62988). The sgRNA together with the HDR template to introduce the 1507C>T mutation ...
-
bioRxiv - Microbiology 2023Quote: ... encoding the Spike glycoprotein of Wuhan SARS-CoV-2 fused to a C-terminal C9 tag (SW) was a kind gift from Fang Li (Addgene plasmid # 145032 ...
-
bioRxiv - Cell Biology 2023Quote: ... cDNAs encoding either APC/C resistant (APC/CR) mVenus-cyclin A2 or mVenus-cyclin B1 were cloned into pINDUCER20 (plasmid #44012; Addgene) by replacing the gateway cassette sequence and were synthesized by Twist Biosciences ...
-
bioRxiv - Cell Biology 2023Quote: ... The pCAG-V5-TurboID vector was constructed by inserting the amplified TurboID cDNA containing the V5 epitope (GKPIPNPLLGLDST) sequence at the N-and C-terminal sites into the pCAGGS expression plasmid (Addgene). Expression plasmids encoding V5-TurboID-Solo and Solo-TurboID-V5 were constructed by inserting amplified Solo cDNA with a GS-linker (GGGSx2 ...
-
bioRxiv - Biophysics 2023Quote: ... human SLC26A9 (WT and missense mutants) with a C-terminally attached mTurquoise (mTq2) tag were cloned into a pSBtet-pur vector (Addgene) using SfiI sites ...
-
bioRxiv - Cell Biology 2024Quote: ... followed by digestion of amplified PCR product with AgeI and NotI and ligation C-terminal to Smo in Smo-mCherry (Addgene plasmid 55134 ...
-
bioRxiv - Cell Biology 2024Quote: ... The sequences were subsequently cloned in the destination vector MAC-tag-C, a gift from Markku Varjosalo (Liu et al., 2018) (Addgene plasmid # 108077 ...
-
bioRxiv - Molecular Biology 2024Quote: The human codon optimized SsdAtox domain was synthetized (Integrated DNA Technologies) and cloned into either the N-terminus or C-terminus of a modified pCMV_BE4max vector (Addgene #112093) with the UGI domain deleted ...
-
Autophagy suppression in DNA damaged cells occurs through a newly identified p53-proteasome-LC3 axisbioRxiv - Cell Biology 2024Quote: ... monolayers of HCT116 cells incubated at 37 °C and under 5% CO2 were transfected with RedTrackCMV (vector control; #50957, Addgene) or RedTrackCMV-LC3B (RedTrackCMV containing the gene encoding LC3B ...
-
Autophagy suppression in DNA damaged cells occurs through a newly identified p53-proteasome-LC3 axisbioRxiv - Cell Biology 2024Quote: ... monolayers of HCT116 cells incubated at 37 °C and under 5% CO2 were transfected with RedTrackCMV (vector control; #50957, Addgene) or RedTrackCMV-LC3B (RedTrackCMV containing the gene encoding LC3B ...
-
bioRxiv - Synthetic Biology 2024Quote: ... or N- and C-terminal parts were amplified in separate PCR reactions using constructs by Rihtar et al (45) obtained from Addgene (vectors were kind gifts from Roman Jerala ...
-
bioRxiv - Developmental Biology 2024Quote: ... with a C-terminal TwinStrep-tag (IBA LifeScience) joined by a 3xGlyGlyGlySer linker was also inserted into the pHLsec vector (Addgene_99845) between AgeI and KpnI restriction sites ...
-
bioRxiv - Developmental Biology 2024Quote: ... with a C-terminal TwinStrep-tag (IBA LifeScience) joined by a 3xGlyGlyGlySer linker was inserted into the pHLsec vector (Addgene_99845) between AgeI and KpnI restriction sites ...
-
bioRxiv - Biochemistry 2024Quote: Cloning of FRET constructs –Both ErCry4a and ErRBP1 were cloned in both an N-terminally tagged version as well as a C-terminally tagged version using the plasmids pmTurquoise-C1 and pmTurquoise-N1 (both a gift from Dorus Gadella (Addgene plasmid # 60558 ...
-
bioRxiv - Cancer Biology 2024Quote: ... GST-SH2 SHC1 (#46486)13 and GST-SH2 (encompassing both the N- and C-terminus) SHP2 (#67575)14 were purchased from Addgene. Phospho-Y222 antibody was developed using peptide CDQRGQSI-pY222-STSFPQP ...