Labshake search
Citations for Addgene :
301 - 350 of 1338 citations for Mouse Anti Herpes Simplex Virus 2 gD 0192 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... Whole-cell patch-clamp recordings were also performed for functional evaluation of Cl− microdomains (Figure 1) on organotypic slices of DLX-Cre mice which were transfected on the day of slicing with tdTomato virus (Addgene-AAV9-CAG-FLEX-tdTomato ...
-
bioRxiv - Neuroscience 2021Quote: ... Rats were given intra-CeA microinjections of AAV8-hSyn-DIO-HA-hM3D(Gq)-IRES-mCitrine (Addgene, 50454-AAV8; Active Virus) or AAV5-hSyn-DIO-EGFP (Addgene ...
-
bioRxiv - Neuroscience 2020Quote: ... P5-7 WT C57Bl/6 mice were used for the injection of AAV9 virus under human synapsin promoter (pAAV9.hSyn.iGluSnFR, commercially available from Addgene, USA) to drive transgenic expression of iGluSnFR in SGNs ...
-
bioRxiv - Neuroscience 2020Quote: Recombinant adeno-associated virus (AAV) vector expression imaging of enhanced green fluorescent proteins (eGFP): Stereotaxic injection of AAV8-CAG-GFP (Addgene ID ...
-
bioRxiv - Cell Biology 2022Quote: ... Lentiviral packaging plasmid psPAX2 and pMD2.G encoding the vesicular stomatitis virus glycoprotein were gifts from Didier Trono (Univ. of Geneva) and purchased from Addgene (http://n2t.net/addgene:12260 and http://n2t.net/addgene:12259 ...
-
bioRxiv - Microbiology 2022Quote: ... immediate-early enhancer/promoter region was replaced with a 0.6kb minimal Ubiquitous Chromatin Opening Element (UCOE) sequence and a Spleen Focus Forming Virus (SFFV) promoter derived from pMH0001 (Cat. n° 85969, Addgene). An internal ribosomal entry site (IRES ...
-
bioRxiv - Bioengineering 2022Quote: ... while the other was transduced with either an inhibitory or excitatory DREADDs virus (Addgene, cat# 50475-AAVrg and 50474-AAVrg). Assembloids were made 1-week prior to recording by placing one of each spheroid type into a 1.7 mL tube together ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... A virus lacking the hM4Di DREADD gene and only containing the green fluorescent tag eGFP (AAV8-CaMKIIa-EGFP, packaged by Addgene) was also infused into OFC in separate groups of animals as a null virus control ...
-
bioRxiv - Neuroscience 2021Quote: Cre-dependent adeno-associated virus (AAV; serotypes 5 or 9) was used to express GCaMP6s (AAV5-Syn-Flex-GCaMP6s, Addgene), or GCaMP7f (AAV9-Syn-Flex-jGCaMP7f-WPRE ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Pseudotyped viruses harbouring the glycoprotein of vesicular stomatitis virus (VSV-G) were produced following the same protocol by using VSV-G envelope expression vector pMD2.G (#12259, Addgene). The culture media was replaced 12-16 h after transfection with fresh DMEM High Glucose (Sigma– Aldrich ...
-
bioRxiv - Neuroscience 2020Quote: To express oChIEF-mCitrine in pOXR1-Cre mice, a recombinant adeno-associated virus (rAAV, serotype 1, 4.8×1013 VC/ml titer) expressing FLEXed oChIEF-mCitrine (Addgene #50973) was package by Vector Biolabs (Malvern ...
-
bioRxiv - Neuroscience 2020Quote: ... and 0.1 μL of adeno-associated virus serotype 9 (AAV9) carrying GCaMP6f under the excitatory neuronal promoter CaMKII (AAV-CaMKII-GCaMP6f) (Addgene) to co-transfect the TRPV1 and GCaMP6f into neurons.
-
bioRxiv - Immunology 2021Quote: ... The lentiviral HLA-C expression plasmids were co-transfected with the vesicular stomatitis virus-G envelope plasmid pMD2.G (Addgene) and packaging plasmid psPAX2 (Addgene) ...
-
bioRxiv - Pathology 2021Quote: ... of adeno-associated virus serotype 8 encoding Cre recombinase under the hepatocyte-specific thyroid binding globulin promoter (AAV8-TBG-Cre) (Addgene) followed by a 12 days (12d ...
-
bioRxiv - Physiology 2021Quote: ... Adeno-associated virus serotype 8 (AAV8) with the thyroxine-binding globulin promoter (TBG) promoter expressing Cre (Addgene, AV-8-PV1091) were injected via tail vein at a dose of 1×1012 genomic copies per mouse on GD8 ...
-
bioRxiv - Neuroscience 2021Quote: ... or Adora2aCre mice injected in dorsolateral striatum with an adeno-associated virus (AAV) encoding Cre-dependent tdTomato (Addgene; #28306-AAV1). Experiments were carried out using both male and female mice heterozygous for all transgenes at 8—24 weeks of age.
-
bioRxiv - Neuroscience 2021Quote: Recombinant adeno-associated virus (AAV) vector containing a CCL2 expression cassette w as generated by replacing GFP cassette of pAAV-CAG-GFP (Addgene) with the full-length c DNA for CCL2 (OriGene) ...
-
bioRxiv - Immunology 2020Quote: ... pCMV-VSV-G plasmid encoding for the vesicular stomatitis virus glycoprotein was a gift from Bob Weinberg (Addgene plasmid #8454). LeGO-G2 ...
-
bioRxiv - Neuroscience 2022Quote: ... 250nl of an anterograde adeno-associated virus (AAV) vector expressing a green fluorescent protein under the hSyn (human synapsin) promoter (AAV5-hSyn-eGFP; Addgene) was injected into ACC to fluorescently mark the anatomical boundary of the claustrum (White et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... 6 mice from each line were injected bilaterally with a pAAV9-CAG-Flex.GCaMP6s.WPRE.SV40 virus (Addgene, titre ≥ 1×1013 vg/mL) in the medial NAc shell (D1-cre and D2(A2a)-cre mice ...
-
bioRxiv - Neuroscience 2022Quote: ... An adeno-associated virus (AAV) solution expressing the CaMPARI2 sensor (hsyn-NES-his-CaMPARI2-WPRE-SV40, Addgene catalog number 101060) was injected into two locations ...
-
bioRxiv - Neuroscience 2023Quote: ... 500 nl of AAV (AAV8-hSyn-DIO-mCherry, plasmid from Addgene #44361, virus packed at UNC Vector Core 109; AAV8-hSyn-DIO-hM3Dq-mCherry plasmid from Addgene #50459 ...
-
bioRxiv - Neuroscience 2023Quote: ... adeno-associated virus (AAV) construct that allows Cre-mediated expression of the transgene (pAAV-EF1A-DIO-WPRE-pA vector; RRID Addgene_39320) (Belmer et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... were injected in the right IC with the recombinant adeno-associated virus (rAAV) rAAV1/ Syn-Flex-Chronos-GFP (Lot # AV6551B, UNC Vector Core, Addgene # 62725 ...
-
bioRxiv - Plant Biology 2023Quote: ... and experiment calibrator plasmids (pEPSW1KN0034 and pEPSW1KN0072) for ratiometric quantification were assembled from CaMV35sP:tobacco mosaic virus (ΩTMV) (pICH51277, Addgene #50268) + firefly luciferase (LucF ...
-
bioRxiv - Neuroscience 2023Quote: ... we bilaterally (2-2.5 mm lateral and 3.5-4.0 mm posterior from Bregma) injected 1 uL of the conditional GtACR2 virus (AAV5-hSyn1-SIO-stGtACR2-FusionRed, Addgene #105677), or 1uL saline injection for controls ...
-
bioRxiv - Neuroscience 2023Quote: ... The TeNT virus was obtained from Stanford Gene Vector and Virus Core while the GFP-expressing construct (50457-AAV5) and retrograde-transported Cre (107738-AAVrg) were obtained from Addgene. After injection ...
-
bioRxiv - Neuroscience 2023Quote: A glass capillary pulled to a fine tip was pre-loaded with a retrograde virus expressing both GFP and channelrhodopsin (ChR2) (pAAV-Syn-ChR2(H134R)-GFP (Addgene, 7 x 1012 vg/ml in PBS/NaCl/pluronic acid F-68 ...
-
bioRxiv - Microbiology 2023Quote: ... and pCAG D12L(ID:89161) and a Nelson Bay Virus syncytia inducing plasmid pCAG Fast p10 (ID:89152) were purchased from Addgene. pCI-S2 (T1L ...
-
bioRxiv - Neuroscience 2023Quote: ... rats received bilateral infusion (300nL/side) of a synapsin-driven GCaMP7s-expressing virus (AAV9-hSyn-GCaMP7s-WPRE; Addgene, Watertown, USA) at the following coordinates ...
-
bioRxiv - Neuroscience 2023Quote: ... A virus lacking the hM4Di DREADD gene and instead containing the fluorescent tag eGFP (AAV8-CaMKIIa-EGFP, packaged by Addgene) was infused into ACC in 4 animals as a null virus control ...
-
bioRxiv - Neuroscience 2023Quote: ... we performed an additional control experiment in which we injected a cre-dependent mCherry virus (pAACV-hSyn-DIO-mCherry; a gift from Bryan Roth; Addgene plasmid #50459 ...
-
bioRxiv - Microbiology 2023Quote: Library virus was generated and titrated as described above using the Brunello sgRNA pool library in lentiGuide-Puro (Addgene, 73178). In all cases ...
-
bioRxiv - Bioengineering 2023Quote: ... The entire tissue culture (between DIV3 and DIV5) was transfected with 1 µL AAV1-hSyn1-GCaMP6f-P2A-nls-dTomato virus (Addgene viral prep #51085-AAV1 ...
-
bioRxiv - Neuroscience 2022Quote: ... Virus-mediated anterograde tracing from MEC used injections of either AAV1-CAG-FLEX-tdTomato (Addgene, viral prep no. 28306- AAV1) or AAV9-CAG-FLEX-GFP (UNC vector core ...
-
bioRxiv - Neuroscience 2024Quote: ... all mice were unilaterally injected with 800nL of AAV9-syn-GCaMP8m-WPRE at a titer of 1.2e12 (Addgene virus #162375) in the RSC ...
-
bioRxiv - Neuroscience 2023Quote: ... This is achieved by delivering CRE at a specific embryonic day (E14.5 or E17.5) through the injection of AAV-CaMKII-Cre virus (Addgene: 105558-AAV1) into the left lateral ventricle of the animals ...
-
bioRxiv - Neuroscience 2024Quote: ... to express channelrhodopsin (ChR2) or control virus (n = 4, AAV-Ef1a-fDIO-mCherry, 200 mL, 3 × 1012 GC/mL; Serotype: 9; Addgene) was unilaterally injected over 10 minutes into the MePD using a 2-µL Hamilton microsyringe (Esslab ...
-
bioRxiv - Neuroscience 2024Quote: ... were injected with 150 nL of a Cre-dependent AAV virus expressing YFP [pAAV-CAG-DIO-ChR2(H134R)-eYFP] (#127090-PHPeB, Addgene) into the FC region at 1 x 10%* transducing units per ml (FC coordinates of the bilateral injections at 15 degrees were ML ...
-
bioRxiv - Neuroscience 2020Quote: ... CRISPR guide RNA sequences (sgRNA#1 TTGTTGCCCAGGGTTTAACA and sgRNA#2 CCCATCCCCGGCACCGGGTC) targeting the mouse Nlk locus were cloned into pSpCas9n(BB)-2A-Puro (Addgene #62987; PX462). Cells were transfected with gRNA and Cas9n-expressing plasmids using Lipofectamine 2000 and successfully transfected cells were selected with 3μg ml-1 puromycin for two days ...
-
bioRxiv - Neuroscience 2020Quote: ... and the retrograde virus carrying Cre (AAV retrograde pmSyn1-EBFP-Cre, 7.6 × 1012 GC/ml) were purchased from Addgene (Watertown, MA).
-
bioRxiv - Microbiology 2020Quote: ... Vesicular stomatitis virus G protein (VSV-G) pseudotyped lentiviruses expressing human ACE2 were produced by transient co-transfection of pMD2G (Addgene #12259) and psPAX2 (Addgene #12260 ...
-
bioRxiv - Neuroscience 2019Quote: ... Virus expressing the full length Phf15 cDNA or empty vector control were co-transfected with pCL-10 A1 (Addgene plasmid #15805)[30] in HEK293T cells using Lipofectamine 3000 (Life Technologies ...
-
bioRxiv - Neuroscience 2022Quote: ... We injected a viral cocktail of AAV5-CamKIIa-C1V1(E122T/E162T)-TS-eYFP-WPRE-hGH (2.5 × 1012 virus molecules/ml; Penn Vector Core, University of Pennsylvania, PA, USA, Addgene number: 35499) in the primary sensory (S1 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Synthetic and control promoter parts were assembled with the omega 5’ untranslated region from tobacco mosaic virus (5UTR-ΩTMV; pICH41402, Addgene #50285), the coding sequence of firefly luciferase (LucF ...
-
bioRxiv - Neuroscience 2019Quote: ... as described(Wickersham et al., 2015) but with the use of the vesicular stomatitis virus envelope expression plasmid pMD2.G (Addgene 12259) for all vectors except for LV-U-TVA950(B19G) ...
-
bioRxiv - Genetics 2020Quote: ... were transduced at a low multiplicity of infection (MOI) with virus containing sgRNA library cloned in lentiGuide-Puro (Addgene plasmid 52963) to ensure that most cells received only one sgRNA in expansion phase medium42 ...
-
bioRxiv - Neuroscience 2021Quote: ... received a bilateral injection of transsynaptic Cre-inducing anterograde virus (AAV1-hSyn-Cre-WPRE-hGH, Penn Vector Core via Addgene, V24784) mixed with a Cre-dependent tdTom-expressing reporter virus to visualize injection sites (AAV2-Ef1a-flex-tdTomato ...
-
bioRxiv - Neuroscience 2022Quote: ... P1 Syngap1+/fl mice were injected with an rAAV9-packaged Cre-GFP expressing virus (pENN.AAV.CamKII.HI.GFP-Cre.WPRE.SV40: Addgene #105551-AAV9: Titer = 5.66×1013 GC/ml) via the superficial temporal vein (STV ...
-
bioRxiv - Neuroscience 2022Quote: ... P1 Syngap1+/fl crossed to Ai9 mice were injected with an rAAV9-packaged Cre-expressing virus (pENN.AAV.hSyn.Cre.WPRE.hGH; Addgene # 105553-AAV9; Titer 2.3 x 1013). Briefly ...