Labshake search
Citations for Addgene :
551 - 600 of 1338 citations for Mouse Anti Herpes Simplex Virus 2 gD 0192 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2022Quote: pcDNA3-SARS-CoV-2-S-RBD-sfGFP (Addgene #141184) and pcDNA3-R4-uAb (Addgene #101800 ...
-
bioRxiv - Pathology 2022Quote: ... pTwist-EF1alpha-SARS-CoV-2-S-2xStrep (Addgene #141382)28 was used ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μg of pMtnA FLAG-IntS6 puro (Addgene #195076) or pMtnA FLAG-IntS12 puro (Addgene #195077 ...
-
bioRxiv - Neuroscience 2022Quote: ... 2) AAV1.CAG.tdTomato (5.06×1012 GC/kg; Addgene #59462), 3 ...
-
bioRxiv - Neuroscience 2023Quote: ... AAVDJ-ef1a-fDIO-EYFP (Addgene 55641, titer 2×1011), AAVDJ-Ef1a-mCherry-IRES-cre (Addgene 55632 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 2 μg of pCMV6M-Pak1-WT (Addgene, 12209), pCMV6M-Pak1-T423E (Addgene ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse Lhx2 cDNA was amplified from TetO-FUW-Lhx2 (Addgene #61537 ...
-
bioRxiv - Cell Biology 2022Quote: Mouse Drp1 was PCR amplified from pcDNA3.1 mDrp1 (Addgene #34706) and cloned into pLenti BlastR using InFusion cloning ...
-
bioRxiv - Molecular Biology 2020Quote: Mouse GFP-PGC-1α full length (FL) plasmid (Addgene, #4) was used as template for PCR amplification of a delta C-terminal domain (ΔCTD ...
-
bioRxiv - Cell Biology 2021Quote: The pcDNA 3.1 (-) mouse C/EBPδ expression vector (AddGene, #12559) and annealed oligonucleotides (Supplementary Table S4 ...
-
bioRxiv - Biophysics 2023Quote: ... Mouse TRPM5 in pcDNA3.1 was purchased from Addgene (plasmid #85189), human TRPM5 in pcDNA3.1+ (Accession No ...
-
bioRxiv - Molecular Biology 2023Quote: ... untagged mouse cDNA into a pBig1a vector70 (Addgene, Plasmid #80611). These untagged RING1B and BMI1 constructs were used for all experiments presented in this manuscript with the exception for the data presented in Figure 6C ...
-
bioRxiv - Molecular Biology 2024Quote: Mouse Two Plasmid Activity-Optimized CRISPR Knockout Library (Addgene#1000000096) was amplified in E coli ...
-
bioRxiv - Cancer Biology 2024Quote: The mouse GeCKO v2 library was obtained from Addgene (#1000000052). LentiCRISPRv2 is a one-vector plasmid system for the mouse GeCKO (Genome-scale CRISPR Knockout ...
-
bioRxiv - Neuroscience 2020Quote: Stereotaxic injection of AAV-EF1a-DIO-HChR2(H134R)-eYFP (serotype 2/1 or 2/9, U. Penn Vector Core, Philadelphia, PA, USA or Addgene, Watertown, MA, USA) was performed in 6-8 weeks old DAT-IRES-Cre or FoxP2-Cre transgenic mice ...
-
bioRxiv - Bioengineering 2020Quote: pcDNA3-SARS-CoV-2-S-RBD-sfGFP (Addgene Plasmid #141184) and pcDNA3-SARS-CoV-2-S-RBD-Fc (Addgene Plasmid #141183 ...
-
bioRxiv - Immunology 2022Quote: ... pTwist-SARS-CoV-2 Δ18 B.1.351v1 (Addgene, no.169462) for Beta-S protein was a gift from Alejandro Balazs26 ...
-
bioRxiv - Biochemistry 2021Quote: ... SARS-CoV-2 3xFlag-His-nsp5CS-nsp14 (Addgene ID 169163) and SARS-CoV-2 nsp14/nsp10-His-3xFlag (Addgene ID 169164 ...
-
bioRxiv - Biochemistry 2021Quote: Plasmids SARS-CoV-2 nsp10-His-3xFlag (Addgene ID 169162), SARS-CoV-2 3xFlag-His-nsp5CS-nsp14 (Addgene ID 169163 ...
-
bioRxiv - Biochemistry 2021Quote: ... and SARS-CoV-2 3xFlag-nsp5CS-nsp14 (Addgene ID 169159). To express nsp10-14 and nsp14-10 fusion proteins ...
-
bioRxiv - Neuroscience 2020Quote: ... or 2) the depolarizing opsin Channelrhodopsin (AAV1.EF1a.DIO.hChR2.EYF; Addgene) was expressed in a cre-dependent manner in interneurons using Gad2-IRES-Cre C57BL/6J mice (Jackson Laboratory) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 2 μg of pMD2.G plasmid (Addgene plasmid # 12259) per well with LipoD293™ In Vitro DNA Transfection Reagent ...
-
bioRxiv - Genomics 2021Quote: ... 375 ng of Prime Editor-2 enzyme plasmid (Addgene #132776) and 125 ng of pegRNA plasmid were mixed and prepared with a transfection reagent (Lipofectamine 3000 ...
-
bioRxiv - Cell Biology 2022Quote: ... we used the 2-vector system (lenti-guide Puro; Addgene #1000000049 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 2 μg of pMD2.G coat protein vector (Addgene plasmid #12259 ...
-
ISL2 is an epigenetically silenced tumor suppressor and regulator of metabolism in pancreatic cancerbioRxiv - Molecular Biology 2020Quote: ... Sabatini lab (MIT) (Wang et al., 2; Addgene Catalogue # 51047). The libraries were amplified using published protocol at Addgene ...
-
bioRxiv - Biochemistry 2019Quote: ... 0.1 μg of the envelope plasmid (pMDG.2, RRID: Addgene_12259) and 0.9 μg of the packaging plasmid (psPAX2 RRID ...
-
bioRxiv - Immunology 2021Quote: ... and pcDNA 3.1-SARS-CoV-2 Spike (Addgene plasmid #145032) for 72 hours at 37°C under 5% (v/v ...
-
bioRxiv - Immunology 2021Quote: ... using pcDNA3-SARS-CoV-2-RBD-8his (Addgene #145145, (33)) as template ...
-
bioRxiv - Cell Biology 2022Quote: ... pEGFP-ZO-2 was a gift from Marius Sudol (Addgene plasmid # 27422 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 μg of Gag and Pol (pMDLg/pRRE, Addgene #12251), and 2 μg of VSV-G envelope expressing plasmid (pMD2.G ...
-
bioRxiv - Developmental Biology 2023Quote: ... pBS-KS-attB2-SA(2)-T2A-GAL4DBD-Hsp70 (Addgene #62904), pBS-KS-attB2-SA(0)-T2A-VP16AD-Hsp70 (Addgene #62905) ...
-
bioRxiv - Microbiology 2023Quote: ... and 2 mg Gag-Pol expression vector psPAX2 (Addgene #12260) using Jet Pei reagent (Polyplus ...
-
bioRxiv - Microbiology 2023Quote: ... or pTwist-SARS-CoV-2 Δ18 B.1.1.529 (Addgene, 179907) or a pTwist empty vector (250 ng ...
-
bioRxiv - Neuroscience 2023Quote: ... 1.0 µL of pAAV.Syn.Flex.GCaMP6s.WPRE.SV40 (diluted 1:2 in dPBS; Addgene: 100845-AAV5 ...
-
bioRxiv - Systems Biology 2024Quote: ... each promoter was transferred to the pMW#2 (Addgene #13349) and pMW#3 (Addgene #13350 ...
-
bioRxiv - Microbiology 2023Quote: ... or pTwist-SARS-CoV-2 Δ18 B.1.1.529 (Addgene, 179907), incubated overnight at 37°C with 5% CO2 and fixed with 3.7% PFA for 20 minutes ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 2 μg pMD2.G envelope plasmid (Addgene plasmid #12259). Medium was changed 16 h after transfection and lentiviral particles were harvested 24 h later ...
-
bioRxiv - Genomics 2019Quote: ... from mouse tail genomic DNA and pX330 plasmid (Cat. 42230, Addgene), respectively ...
-
bioRxiv - Cancer Biology 2022Quote: Guides were quantified against the Yusa Mouse V2 library (Addgene #67988) using crisprReadCounts v1.3.1 (https://github.com/cancerit/crisprReadCounts) ...
-
bioRxiv - Neuroscience 2020Quote: ... Mouse nAChR alpha4 CFP was a gift from Henry Lester (Addgene plasmid # 15244 ...
-
bioRxiv - Biochemistry 2021Quote: Mouse Bpnt2 cDNA was cloned into the pBABE-puro (Addgene #1764) retroviral vector using BamHI and SalI restriction sites ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... a mouse KO sgRNA pooled library (Addgene: #1000000096, 10sgRNA per gene) was amplified at 1000X fold coverage ...
-
bioRxiv - Physiology 2020Quote: ... the mouse N-Shh sequence was then cloned in pRRLsin.MND.MCS.WPRE (Addgene) that had been previously digested by NheI and PmlI ...
-
bioRxiv - Cell Biology 2020Quote: ... Mouse Mannosidase II amino acids 1-116 was amplified from Addgene plasmid #65261 using a forward primer that contains an XbaI site and a reverse primer with an MluI site and further subcloned upstream of the mCherry open reading frame.
-
bioRxiv - Cell Biology 2022Quote: Mouse SEPT6-GFP construct was purchased from Addgene (Addgene plasmid# 38296) and was cloned into the pLVX-IRES-puro vector (Clontech) ...
-
bioRxiv - Immunology 2023Quote: pcDNA3-N-Flag-NLRP3 plasmid encoding mouse NLRP3 (Addgene plasmid # 75127) was a gift from Bruce Beutler61 ...
-
bioRxiv - Molecular Biology 2023Quote: The Mouse Improved Genome-wide Knockout CRISPR Library v2 (Addgene #67988) collection sgRNAs in lentiviral vectors targeting 18 ...
-
bioRxiv - Cell Biology 2022Quote: ... GGAACAAGTTCAGTGAACTG, #3: TGCATGCTCACTGATAATGA), IFIH1 (#1: CTTGGACATAACAGCAACAT, #2: TGAGTTCCAAAATCTGACAT) or TLR3 (#1: ACGACTGATGCTCCGAAGGG, #2: ACTTACCTTCTGCTTGACAA, #3: GGAAATAAATGGGACCACCA) and control gRNAs (Addgene plasmid #51763, #51762 and #51760) were ligated into pLentiCRISPRv2 (Addgene plasmid # 52961 ...
-
bioRxiv - Genetics 2020Quote: Mouse Arid1a gRNA (GCTGCTGCTGATACGAAGGTTGG) was cloned into LentiGuide-puro plasmid (Addgene #53963). LentiCas9-Blast plasmid was purchased from Addgene (Addgene #53962) ...