Labshake search
Citations for Addgene :
301 - 350 of 2409 citations for 7 Chloro 4 hydroxy 1 8 naphthyridine 3 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: To generate the nrfl-1(null) deletion allele a mix containing Peft-3::Cas9 (Addgene #46168; 50 ng/μl), two pairs of sgRNA plasmids targeting the 5’ or 3’ ends of the nrfl-1 open reading frame (75 ng/μl each) ...
-
bioRxiv - Immunology 2021Quote: ... HIV-1 dual reporter vector expressing mCherry and luciferase (NL4-3 mCherry Luciferase, plasmid#44965) was purchased from Addgene. Plasmid expression a C-terminally truncated SARS-CoV-2 S protein (pSARS-CoV-2Δ19 ...
-
bioRxiv - Genomics 2022Quote: pNLZ10 (Pfib-1::NLS::dCas9::24xGCN4::NLS::tbb-2 3’UTR) construct contains pCFJ150 vector backbone (Addgene plasmid # 19329). SV40 NLS::dCas9::egl-13 NLS: ...
-
bioRxiv - Genomics 2023Quote: ... Both gRNA (1 µg each) vectors were co-transfected with 3 µg of pCas9_GFP (a gift from Kiran Musunuru; Addgene plasmid #44719 ...
-
bioRxiv - Cancer Biology 2024Quote: ... GGTGAGGTGGAAATGAGCCA; HK1-3: GGAGGGCAGCATCTTAACCA) and HK2 (HK2-1: GATGCGCCACATCGACATGG; HK2-2: TAAGCGGTTCCGCAAGGAGA) was cloned into lentiCRISPR v2 construct (RRID:Addgene_52961) using a protocol available online (Zhang_lab_LentiCRISPR_library_protocol.pdf) ...
-
bioRxiv - Neuroscience 2023Quote: ... and ectodomain (52-750 amino acids) of the NEP (#7283, Addgene) were used for the fusion protein and then inserted in rAAA-FLEX-axonGCaMP6s-P2A-mRUBY3 vector (#112008 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 4 μg pUMVC (Addgene, 8449) and 18 μg transfer plasmid were mixed in 700 μL DMEM medium (Corning ...
-
bioRxiv - Neuroscience 2023Quote: ... was injected AAV1.Syn-GCaMP6m (pAAV.Syn.GCaMP6m.WPRE.SV40 from Addgene, #100841, titer 6-8 ✕ 1012). To express tdTomato in GABAergic neurons ...
-
bioRxiv - Bioengineering 2024Quote: ... pFA6a-link-yoEGFP-SpHis5 (primers OM-8 and OM-9) (Addgene plasmid #44836), and pBTK522::FAST-PETase 21 (gift from Hal Alper ...
-
bioRxiv - Cell Biology 2022Quote: ... mKeima-Red-Mito-7 plasmid was a gift from Michael Davidson (Addgene plasmid #56018; www.addgene.org/56018). MitoTracker Deep Red FM ...
-
bioRxiv - Neuroscience 2021Quote: ... 200 nL total of AAVrg-hSyn-GFP (Addgene 50465-AAVrg; titer 7×10^12 vg/mL) was unilaterally injected at a rate or 2 nL/sec into the mPFC (100 nL in IL ...
-
bioRxiv - Systems Biology 2021Quote: RTK constructs were obtained from three sources: 7 were gifts from William Hahn & David Root (Addgene plasmid # 23914 ...
-
bioRxiv - Cell Biology 2021Quote: ... The following expression constructs were a kind gift from Michael Davidson: eGFP-actin-7 (Addgene #56421), mEmerald-actin-N-10 (Addgene #53979) ...
-
bioRxiv - Neuroscience 2020Quote: ... we intracranially injected 200 nL of AAV5-hSyn-DIO-hM3D(Gq)- mCherry (Addgene, titer: 7 × 1012) into both the left and right BLA at coordinates AP ...
-
bioRxiv - Microbiology 2022Quote: Plasmids used in this study include mEmerald-Mito-7 (a gift from Dr. Michael Davidson (Addgene plasmid # 54160 ...
-
bioRxiv - Neuroscience 2022Quote: [7] GCaMP6s from pGP-CMV-GCaMP6s (a gift from Douglas Kim & GENIE Project, Addgene ID # 40753) (Chen et al. ...
-
bioRxiv - Molecular Biology 2022Quote: ... primers 1033F-1038F were individually mixed with primer 1039R and pLdCH plasmid DNA (Addgene #84291, (7)) to amplify an sgRNA expression cassette ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... TG+ controls received identical bilateral infusions of AAV5-hSyn-DIO-mCherry (7×1012 vg / mL; Addgene) and TG-controls received sterile saline.
-
bioRxiv - Neuroscience 2023Quote: ... The virus carried either a red calcium indicator alone (7 mice; jRGECO1a; AAV1.Syn.NES.jRGECO1a.WPRE.SV40; a gift from Douglas Kim & GENIE Project (Addgene plasmid # 100854 ...
-
bioRxiv - Neuroscience 2023Quote: ... we injected a Cre-dependent AAV (AAV5-syn-FLEX-jGCaMP7f-WPRE (Addgene: 7×1012 vg/ml)) in the zona incerta of Vgat-cre mice (Jax 028862 ...
-
bioRxiv - Immunology 2024Quote: ... HEK293T cells were transfected with the lentiviral vector pScalps-EGFP-Cre recombinase (7) (Addgene plasmid 207132) together with the packaging vectors psPAX2 and pMD2.G (Addgene plasmids 12260 and 12259 by Didier Trono ...
-
bioRxiv - Neuroscience 2023Quote: ... or AAV-hSyn-DIO-hM4D(Gi)-mCherry (400 nl at titer 7×1012, Addgene, #44362-AAV5) for inhibition ...
-
bioRxiv - Neuroscience 2023Quote: Anterograde transsynaptic expression was done with AAV1-cre (AAV1.CamKII0.4.Cre.SV40, 7×10¹² vg/mL, Addgene). Retrograde transsynaptic expression was performed with starter vector (AAV-DIO-Ef1a-TVA-FLAG-2A-N2C_G ...
-
bioRxiv - Neuroscience 2024Quote: ... an anterograde Cre-dependent AAV5-hSyn-DOI-hM4Di-mCherry (7×10¹² vg/mL, plasmid #44362, Addgene) for RLA rats (hM4Di-group ...
-
bioRxiv - Neuroscience 2024Quote: ... or an anterograde Cre-dependent AAV5-hSyn-DOI-mCherry (7×10¹² vg/mL, plasmid #50459, Addgene) for control groups (mCherry control groups ...
-
bioRxiv - Neuroscience 2024Quote: ... RHAs received AAV5-hSyn-DOI-hM3D(Gq)-mCherry (7×10¹²vg/mL, Addgene, plasmid number 44361). Conversely ...
-
bioRxiv - Neuroscience 2024Quote: ... RLAs received AAV5-hSyn-DOI-hM4D(Gi)-mCherry (7×10¹²vg/mL, Addgene, plasmid number 44362). As a control ...
-
bioRxiv - Cancer Biology 2021Quote: ... HT-1080N cells were transduced with lentiviruses carrying the reverse tetracycline-controlled transactivator 3 under a CMV promoter (CMV-rtTA3) (Cat# w756-1, Addgene). HT-1080N-rtTA3 cell lines were selected in 10 μg/mL blasticidin (Cat # A1113902 ...
-
bioRxiv - Cell Biology 2022Quote: ... U2OS 2-6-3 were transduced with pLenti CMV rtTA3 Blast (w756-1, plasmid #26429; Addgene, gift from E. Campeau) for the expression of rtTA ...
-
bioRxiv - Genomics 2022Quote: pNLZ11 (Pfib-1::NLS::scFv::sfGFP::NLS::tbb-2 3′UTR) construct has the pCFJ210 vector backbone (Addgene plasmid # 19329). A codon-optimized scFv::sfGFP fragment [42] was ordered from IDT ...
-
bioRxiv - Cell Biology 2022Quote: The sgRNA oligomers for SLC25A46 targeting exon 1 and 3 were annealed and inserted into plasmid pSpCas9(BB)-2A-Puro (PX459) V2.0 from Addgene (62988) via combined ligation (T7 ligase NEB).
-
bioRxiv - Molecular Biology 2022Quote: ... Virus was generated by plating 3.5×104 COS1 cells per well in a 6 well plate and transfecting them on the 2nd day with 1 ug total plasmid per well at a 5:3:2 ratio of lentiCRISPR:psPAX2(Addgene #12260):pMD2.G(Addgene#12259 ...
-
bioRxiv - Biophysics 2023Quote: Fusion constructs with pTREtight2 vectors were co-transfected with reverse tetracycline-controlled transactivator 3 (pLenti CMV rtTA3 Hygro (w785-1)) plasmid (Addgene) in the presence of doxycycline (Clontech) ...
-
bioRxiv - Cell Biology 2022Quote: ... annealed oligo (5’-CACCGATGACCAACGACGCAAGTTT-3’ and 5’-AAACAAACTTGCGTCGTTGGTCATC-3’) was inserted into PX459 (pSpCas9(BB)-2A-PuroV2.0) (Addgene) (Ran et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... The entire coding sequence of GCaMP6s was amplified by PCR with primers 5’–GGATCCGCCACCATGGGTTCTCATCATCATCA–3’ and 5’–GTAGCCGAACCGGTCTTCGCTGTCATCATTTGTAC–3’ using pGP-CMV-GCaMP6s (Addgene plasmid # 40753; http://n2t.net/addgene:40753; RRID:Addgene_40753) as a template ...
-
bioRxiv - Neuroscience 2020Quote: ... Lin Tian)56 using Q5 polymerase (primers: 5’-aaaagctagcatgaagacgatcatcgccctgagc-3’ and 5’-aaaaaggcgcgcctcaggttgggtgctgaccg-3’) and subcloned into pAAV.CBA.DIO (Addgene #81008)108 backbone between AscI and NheI restriction sites ...
-
bioRxiv - Biochemistry 2022Quote: ... The wild-type 14-3-3 ζ gene was cloned into NcoI/XhoI digested pBAD plasmid (Addgene #85482) with a TEV cleavable C-terminal His6 purification tag ...
-
bioRxiv - Molecular Biology 2023Quote: gRNAs targeting LSM14A (5’-TCTGTACCAAAGGATCGAAC-3’) and XRN1 (5’-AGAGAAGAAGTTCGATTTGG-3’) were cloned into LentiCRISPR v2 (Addgene #52961) using BsmBI restriction enzyme sites and confirmed by sequencing ...
-
bioRxiv - Neuroscience 2023Quote: ... neonatal Swiss Webster or C57Bl/6 (P0–3) mice were anesthetized on ice for 3 min before injecting viral vectors (AAV5.GfaABC1D.GCaMP6f.SV40 [Addgene, 52925-AAV5] ...
-
bioRxiv - Genomics 2020Quote: ... pCFJ104 - Pmyo-3∷mCherry∷unc-54 (Addgene plasmid # 19328 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 3 μg psPAX2 (packaging plasmid; Addgene) was performed using iN-fect (Intron Biotechnology ...
-
bioRxiv - Cell Biology 2021Quote: ... and pGH8 (Prab-3::mCherry, Addgene #19359) (Frøkjaer-Jensen et al. ...
-
bioRxiv - Genomics 2022Quote: ... and 3 μg pMD2.G (Addgene, #12259) into 293T cells cultured in 100 mm dish ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 μg of pGW-PervevalHR (Addgene #57432) (22) ...
-
bioRxiv - Immunology 2021Quote: ... myc (pCSF107mT-GATEWAY-3’-Myc tag, Addgene), green fluorescence protein (GFP ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 3 μg of pVSVg (8454; Addgene); FuGENE HD transfection reagent (Promega ...
-
bioRxiv - Genetics 2022Quote: ... Tc’hsp5’-Gal4Delta-3’UTR] (Addgene plasmid # 86449) was used as a donor plasmid with Piggybac insertion repeats and the 3xP3::EGFP reporter (Schinko et al. ...
-
bioRxiv - Physiology 2023Quote: ... and mPlum-mito-3 (Addgene plasmid #55988) using Fugene6 (Promega Inc. ...
-
bioRxiv - Synthetic Biology 2022Quote: ... MAFA in pX330S-3 (Plasmid #58779, Addgene), Insulin in pX330S-4 (Plasmid #58780 ...
-
bioRxiv - Genomics 2023Quote: ... with 3 μg of psPAX (Addgene, 12260) and 1 μg of pMD2.G (Addgene ...