Labshake search
Citations for Addgene :
201 - 250 of 2409 citations for 7 Chloro 4 hydroxy 1 8 naphthyridine 3 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... (3) AAV8-Syn-ChR2(H134R)-GFP (3×108 g.c.; Addgene #58880-AAV8), and (4 ...
-
bioRxiv - Biochemistry 2022Quote: ... The 3-nitro-tyrosine incorporation plasmid (pAcBac1-3-nitroTyr-A7, Addgene # 141173) was as previously described.35
-
bioRxiv - Cell Biology 2021Quote: ... 3 μg psPAX2 (Addgene), and 3 μg pMD2.G (Addgene ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 (Addgene plasmid #96963)92 ...
-
bioRxiv - Cell Biology 2020Quote: ... and FLAG-tagged FL human TSC2 (1807 amino acids, UniProtKB/Swiss-Prot accession number P49815- 1) were purchased from Addgene, and pRK7 was subcloned with FLAG-tagged human TBC1D7 (293 amino acids ...
-
bioRxiv - Biochemistry 2023Quote: The coding sequence for amino acids 1-110 of GCP2 were PCR amplified from pACEBac1-gamma-TuSC (a gift from Tarun Kapoor (Addgene plasmid # 178079 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Oligos 5’ CACCGATCACCCTCTTCGTCGCTT 3’ / 5’ AAACAAGCGACGAAGAGGGTGATC 3’ and 5’ CACCGCTTAGGCCGGAGCGAGCCT 3’/ 5’ AAACAGGCTCGCTCCGGCCTAAGC 3’ were annealed and cloned into the px458 cut with BsaI (Addgene #48138). Plasmids were transfected into cell lines using Genejuice transfection reagent (Merck ...
-
bioRxiv - Neuroscience 2020Quote: ... the target sequence (5’-GGGTGAAGATCCTGTTCAATA-3’) was shuttled to the pLKO.1-Hygromycin vector (Addgene, #24150). For human astrocytes ...
-
bioRxiv - Cell Biology 2023Quote: ... Both pie-1p and pie-1 3’UTR PCR products were amplified using pPK605 plasmid (Addgene) as the template.
-
bioRxiv - Developmental Biology 2023Quote: Transgenic animals were generated by injecting transgenes (15 ng μl-1 each) mixed with a co-injection marker pRF-4 (120 ng μl-1) (Addgene) expressing a dominant negative variant of the rol-6 gene and an empty vector pSK (up to 200 ng μl-1 of DNA ...
-
bioRxiv - Developmental Biology 2019Quote: ... or the truncation that lacks coding sequence for amino acid 2 to amino acid 180 of Prdm16 was PCR amplified from MSCV-Prdm16 (Addgene 15504) and inserted between the EcoRI and XhoI sites in pCAGIG-NLS-Flag ...
-
bioRxiv - Biochemistry 2019Quote: ... and cloning into linearized pCS2+8 vector (Addgene plasmid #34931). For recombinant expression ...
-
bioRxiv - Neuroscience 2021Quote: ... and AAV2/8-hSyn-DIO-eGFP were obtained from Addgene.
-
bioRxiv - Neuroscience 2021Quote: ... 15μg of pAAV2-8 Rep-Cap plasmid (Addgene plasmid # 112864), and 15μg of pAAV-EF1a-DIO-ChloPhensor ...
-
bioRxiv - Microbiology 2023Quote: ... and pBTK401 (Type 8) (Addgene_65109, Addgene_183127, Addgene_65179, Addgene_183126, Addgene_110593, Addgene_110597), and dsRNA target sequence (Type 3 ...
-
bioRxiv - Cell Biology 2023Quote: GFP tagged WT Keratin 8 in pEGFP-N3 (Addgene 6080) was kindly provided by Dr ...
-
bioRxiv - Microbiology 2023Quote: ... and pBTK401 (Type 8) (Addgene_65109, Addgene_183127, Addgene_65179, Addgene_183126, Addgene_110593, Addgene_110597), and dsRNA target sequence (Type 3 ...
-
bioRxiv - Microbiology 2023Quote: ... and pBTK401 (Type 8) (Addgene_65109, Addgene_183127, Addgene_65179, Addgene_183126, Addgene_110593, Addgene_110597), and dsRNA target sequence (Type 3 ...
-
bioRxiv - Biochemistry 2024Quote: ... mCherry-EB1-8 was a gift from Michael Davidson (Addgene plasmid #55035 ...
-
bioRxiv - Biochemistry 2024Quote: ... were inserted into the pHLmMBP-8 vector (Addgene, cat # 72347)85 using restriction enzymes ...
-
bioRxiv - Immunology 2022Quote: ... a 3’ LTR-restored lentiviral expression vector (Addgene #101337, hereafter LV-3’LTR) expressing a GFP reporter was used to express ACE2 or CD169 ...
-
bioRxiv - Cell Biology 2023Quote: ... Most of the genes related with 14-3-3 were acquired from Addgene and cloned into pMX plasmids ...
-
bioRxiv - Plant Biology 2024Quote: ... Acceptors were pOdd1-4 (pCk1-4, Addgene plasmids # 136695-136698) for Level 1 and 3 and pEven1-4 (pCsA-E ...
-
bioRxiv - Developmental Biology 2020Quote: ... targeting the 5’ (5’-AGTGCGCTTCGTCACTGCAC-3’) and 3’ (5’-TCCTCCCGCCCCGACGCGGA-3’) region of the Spen ORF were cloned in the Cas9-GFP pX458 vector (Addgene plasmid #48138). Compatible 5’ and 3’ Homology arms (HA ...
-
bioRxiv - Synthetic Biology 2019Quote: We modified the vector pX330A_dCas9–1 × 4 (a gift from Takashi Yamamoto, Addgene plasmid #63598) by inserting a gBlock Gene Fragment (Integrated DNA Technologies ...
-
bioRxiv - Cancer Biology 2023Quote: SUDHL-4 cell line was infected using pLKO.1-puro-GFP U6 sgRNA (Addgene #50920) containing BAX RNA guides or non-targeting RNA guide:
-
bioRxiv - Cell Biology 2019Quote: ... mCherry-Golgi-7 was a gift from Michael Davidson (Addgene plasmid: no. 55052) and the cassette was subcloned into a pCSIIbsr vector ...
-
bioRxiv - Bioengineering 2021Quote: ... 2 μL of plasmid DNA (tdTomato-Lifeact-7, 500 ng/ μL, Addgene, 54528), and 96 μL of PBS ...
-
bioRxiv - Cell Biology 2021Quote: Mito-Emerald (mEmerald-Mito-7) was a gift from Michael Davidson (Addgene #54160) 43 ...
-
bioRxiv - Biochemistry 2022Quote: pT7-7 WT α-syn construct (Addgene, USA, gifted from Hilal Lashuel [34]), was transformed into BL21-Gold (DE3 ...
-
bioRxiv - Cell Biology 2019Quote: ... The plasmid mAzurite-Actin-7 (a gift from Michael Davidson Addgene plasmid 55227) was modified by incorporating the M2×24 array with 5’ XbaI and 3’ BclI sites ...
-
bioRxiv - Cancer Biology 2019Quote: mTagRFP-T-Fibrillarin-7 was a gift from Michael Davidson (Addgene plasmid # 58016); GFP-Nucleolin from Michael Kastan (Addgene plasmid # 28176 ...
-
bioRxiv - Physiology 2022Quote: ... cells were transfected with 1μg DsRed2-Mito-7 (Mito-dsRed) (Addgene Plasmid #55838) by lipofectamine (Invitrogen L3000008 ...
-
bioRxiv - Cell Biology 2023Quote: ... Soluble mCherry (pmCherry-N3 plasmid) was cloned from pmCherry-mito-7 (Addgene #55102).
-
bioRxiv - Cell Biology 2024Quote: ... gene targeting sgRNAs (Supp Table 7) were cloned into pX459 (Addgene plasmid #48139) using BbsI (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: ... the sequence encoding the native signal peptide and ECD of GPR56 (amino acids 1-400) was subcloned from pCAG-hGPR56-IRES-GFP (from Christopher A Walsh, Addgene 52297) into pCEP4 (Invitrogen ...
-
Targeted attenuation of elevated histone marks at SNCA alleviates α-synuclein in Parkinson’s diseasebioRxiv - Neuroscience 2020Quote: ... The catalytically active domains of JARID1A enzyme (1-797 amino acids) was amplified from pcDNA3/HA-FLAG-RBP2 plasmid (Addgene #14800), a gift from William Kaelin (Klose et al ...
-
bioRxiv - Physiology 2022Quote: ... or scramble short hairpin RNA (shRNA) (Table 3) was inserted into the plasmid pLKO.1 (8453; Addgene). pSF-lenti or pLKO.1 together with the two helper plasmids psPAX2 (Addgene plasmid 12260 ...
-
bioRxiv - Cell Biology 2020Quote: ... 5′-CAAACAATCAGCAATGCCTG-3′ and 5′-TGAAGTATTCAGAACAGAAG-3′ and cloned into pX330-P2A-EGFP (Addgene) through ligation using T4 ligase (New England Biolabs) ...
-
bioRxiv - Neuroscience 2021Quote: stGtACR2: 300 nL 1:10 AAV2/8-hSyn1-SIO-stGtACR2-FusionRed (working concentration 4.7*1011 gc/mL, Addgene/Janelia Viral Core, Ashburn, VA)
-
bioRxiv - Cell Biology 2020Quote: ... and pET28a(+) (Addgene #69864-3), for His6-tag protein purification ...
-
bioRxiv - Systems Biology 2023Quote: ... and pMW#3 (Addgene #13350) destination vectors using LR Clonase (ThermoFisher) ...
-
bioRxiv - Molecular Biology 2023Quote: - vector pGEX-4T-3 (Addgene_79149) to express only GST protein for alternative screening.
-
bioRxiv - Systems Biology 2024Quote: ... and pMW#3 (Addgene #13350) destination vectors using LR Clonase (ThermoFisher #11791100) ...
-
bioRxiv - Physiology 2021Quote: ... Adeno-associated viruses with a null vector (Addgene, AV-8-PV0148) were used as controls.
-
bioRxiv - Neuroscience 2024Quote: ... The he1.1:YFP cassette (he1.1:YFP_F, he1.1:YFP_R, Table 4) was amplified from p3E_he1a:YFP (Addgene, plasmid #113879), and the polyA terminator (polyA_F ...
-
bioRxiv - Molecular Biology 2024Quote: The HTLV-1 CA (Gag amino acids 132-349) was cloned into the 6×His SUMO bacterial expression plasmid (pHYRSF53, Addgene, Watertown, MA), with mutants created by using the Gibson assembly procedure ...
-
bioRxiv - Biochemistry 2024Quote: The plasmid encoding amino acids 1-393 of the p53 protein with a FLAG tag at the C-terminus (Addgene plasmid #10838) was used as a template for site-directed mutagenesis to delete the N-terminal regions spanning amino acids 1-31 ...
-
bioRxiv - Cell Biology 2020Quote: ... and pT7-7 α-Syn A53T (Addgene plasmid #10572737; http://n2t.net/addgene:105727; RRID:Addgene_105727) (gift from Hilal Lashuel).
-
bioRxiv - Neuroscience 2022Quote: ... we injected AAV1-CAG-FLEXFRT-ChR2(H134R)-mCherry (75470, 7×1012 vg/mL, Addgene). For imaging DA dynamics ...