Labshake search
Citations for Addgene :
301 - 350 of 2738 citations for 1 Piperidineacetamide 4 2 benzothiazolyl N 4 4 morpholinyl phenyl 9ci since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... 1.0 µL of pAAV.Syn.Flex.GCaMP6s.WPRE.SV40 (diluted 1:2 in dPBS; Addgene: 100845-AAV5 ...
-
bioRxiv - Neuroscience 2021Quote: 8-12 weeks old Ucn3::Cre male (n =5) and female (n=3) mice were stereotaxically injected with AAV1-eF1a-DoubleFlox hChR2(H134R)-mCherry-WPRE-HgHpA (Addgene, Cambridge, MA) bilaterally into the PeFA (AP −0.6 ...
-
bioRxiv - Biochemistry 2020Quote: ... according to manufacturer’s instruction and then transferred to pLX302 lentiviral destination vector (addgene) or pDEST-CMV-N-EGFP vector (pDEST-CMV-N-EGFP was a gift from Robin Ketteler (Addgene plasmid # 122842) using recombination utilising the LR-Clonase (Invitrogen ...
-
bioRxiv - Molecular Biology 2024Quote: ... A PCUP1 N-ubiquitin plasmid was constructed by amplifying the CUP1 promoter through N-ubiquitin sequence from the integrating plasmid (Addgene 131169, [56]) and gap repairing it into pRS315 linearized with BamHI ...
-
bioRxiv - Molecular Biology 2020Quote: A pET28a vector with sub-cloned cDNA of Hsp53-(1-73) (72R) and the N-terminal His-tag was procured from Addgene, (plasmid #62082) ...
-
bioRxiv - Biochemistry 2022Quote: ... full-length FUS with an N-terminal histidine tag and maltose-binding protein fusion (pTHMT FUS 1-526, AddGene #98651), and FUS RGG3 with N-terminal histidine tag and MBP fusion (pTHMT FUS RGG3 (453-507) ...
-
bioRxiv - Cell Biology 2022Quote: ... GGAACAAGTTCAGTGAACTG, #3: TGCATGCTCACTGATAATGA), IFIH1 (#1: CTTGGACATAACAGCAACAT, #2: TGAGTTCCAAAATCTGACAT) or TLR3 (#1: ACGACTGATGCTCCGAAGGG, #2: ACTTACCTTCTGCTTGACAA, #3: GGAAATAAATGGGACCACCA) and control gRNAs (Addgene plasmid #51763, #51762 and #51760) were ligated into pLentiCRISPRv2 (Addgene plasmid # 52961 ...
-
bioRxiv - Neuroscience 2021Quote: ... and SAD-B19 helper proteins (N, 52.11 mg, Addgene 59924 ...
-
bioRxiv - Biophysics 2021Quote: ... was fused on the N-terminus of hCdt1 (Addgene #80007 ...
-
bioRxiv - Biophysics 2022Quote: ... N-terminal hexahistidine tag fused construct (Addgene plasmid #98669) with a tobacco etch virus (TEV ...
-
bioRxiv - Biochemistry 2021Quote: ... N-terminal His6 plus glutathione S-transferase (GST; RRID:Addgene_29707); N-terminal His6 plus small ubiquitin-like modifier (SUMO ...
-
bioRxiv - Microbiology 2023Quote: ... were subcloned into pLVpuro-CMV-N-3xFLAG (Addgene #123223) by Gateway cloning ...
-
bioRxiv - Cell Biology 2023Quote: ... mVenus-Integrin-Beta1-N-18 plasmid (Addgene plasmid #56330) was obtained from Addgene (USA) ...
-
bioRxiv - Bioengineering 2023Quote: ... n×GCN4 sequences were derived from plasmid (Addgene #113022) via PCR ...
-
Striated muscle-specific base editing enables correction of mutations causing dilated cardiomyopathybioRxiv - Genetics 2022Quote: ... we used Cbh_v5 AAV-ABE N-terminal (Addgene: 137177) and Cbh_v5 AAV-ABE C-terminal (Addgene ...
-
bioRxiv - Cell Biology 2024Quote: ... N-WASP cDNA was purchased from Addgene (plasmid #33019), PCR amplified and ligated into pEGFP-C1 plasmid using XhoI and EcoRI restrictions sites ...
-
bioRxiv - Neuroscience 2024Quote: ... cohort 1) or AAV9.EF1a.dflox.hChR2(H134R).mCherry.WPRE.HGH (1×10^12 pp/mL, Addgene, cohort 2).
-
bioRxiv - Microbiology 2021Quote: ... Expression vectors for SARS-CoV-2 Wuhan-Hu-1 (Addgene, #149539), SARS-CoV-2 B.1.167.2 (Addgene ...
-
bioRxiv - Cancer Biology 2021Quote: ... gRNA-1 and -2 were cloned into pL-CRISPR.EFS.GFP (Addgene, #57818) and pL-CRISPR.EFS.tRFP (Addgene plasmid #57819) ...
-
Zero-shot learning enables instant denoising and super-resolution in optical fluorescence microscopybioRxiv - Bioengineering 2023Quote: ... and the sgRNA was ligated into pX330A-1×2 (Addgene, 58766). To construct donor vector ...
-
bioRxiv - Genomics 2022Quote: ... and pSLQ1852-2 pHR: U6-SpsgCD95-1 CMV-EGFP (Addgene 84151) with slight modifications ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1000 ng frame selector (pCAS9-mCherry-Frame +0/+1/+2, Addgene plasmid #66939/#66940/#66941 ...
-
bioRxiv - Molecular Biology 2024Quote: ... pLVX-M-2×Strep-IRES-Puro(Addgene#141386, Wuhan-Hu-1) with NotI/BamHI- ...
-
bioRxiv - Molecular Biology 2024Quote: ... pLVX-E-2×Strep-IRES-Puro (Addgene#141385, Wuhan-Hu-1), pLVX-M-2×Strep-IRES-Puro(Addgene#141386 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Microdomain targeting was accomplished using N-terminal fusions of tags to the matrix using 2xCOX8A (tag corresponds to Cox8A N-terminal residues 1-25, from Addgene 136470), the IMS using SMAC (residues 1-59 ...
-
bioRxiv - Developmental Biology 2023Quote: 2.5×105 hESCs (AIC-hESCs or AIC-N hESCs) were electroporated with 1 μg of donor plasmid AAVS1-CAG-hrGFP (Addgene, #52344) or AAVS1-Pur-CAG-mCherry (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: ... PV-cre mice received unilateral injections in the left lobule simplex of 0.7 µl of pAAV-1-hSyn1-Flex-SIO-stGtACR2-FusionRed-dlox (N = 5, 2.0 × 1012 genome copies/mL; Addgene: 105677-AAV1), while another group of PV-cre mice received injections of pAAV-9/2-hSyn1-dlox-tdTomato-dlox-WPRE (N = 3 ...
-
bioRxiv - Biophysics 2024Quote: The genes encoding for full-length and truncated versions of N-protein (Uniprot: P0DTC9) were PCR-amplified from a vector with the cDNA of N-protein acquired from Addgene (pGBW-m4046785; Plasmid #145684). The CC null mutants in which L223 ...
-
bioRxiv - Cell Biology 2021Quote: ... pGEX6P1-N-HA (Andrew Jackson and Martin Reijns, Addgene 119756) was utilized as the backbone for recombinant protein expression E ...
-
bioRxiv - Cancer Biology 2020Quote: ... N-WASP (#54199) and fascin (#54094) were obtained from Addgene. Each insert was cloned into the lentiviral plasmid pCDH-CMV-MCS-EF1-Puro with GFP fusion protein at C-terminus.
-
bioRxiv - Neuroscience 2020Quote: ... excitatory Gq DREADD (AAV8-hSyn-hM3Gq-mCherry; Addgene; n = 10); and control construct (AAV5-hSyn-EYFP ...
-
bioRxiv - Microbiology 2022Quote: ... derived from a pcDNA3.1-hACE2 vector (Cat. n° 145033, Addgene), was inserted into a pLenti6.3 vector (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2020Quote: ... Fyn was amplified from mEos2-FYN2-N-10 (Addgene 57380) and assembled into pBlueScript with either a mec-4 or osm-10 promoter and the unc-54 3’UTR using the NEBuilder HiFi DNA Assembly kit ...
-
bioRxiv - Biochemistry 2021Quote: ... or N-terminal His6 plus green fluorescent protein (GFP; RRID:Addgene_29716). Note that in the plasmid names for this clone the numbering of Syx residues was based on the Syx isoform from NCBI Reference Sequence NP_001036128.1 ...
-
bioRxiv - Biochemistry 2021Quote: ... N-terminal His6 plus small ubiquitin-like modifier (SUMO; RRID:Addgene_29711); or N-terminal His6 plus green fluorescent protein (GFP ...
-
bioRxiv - Molecular Biology 2023Quote: ... H-RASV12 from pBABE-Puro H-RASV12 (n°12545 Addgene) was cloned in a home-made inducible vector derived from pLVX-Tight-Puro (Clontech ...
-
bioRxiv - Genetics 2023Quote: ... for CTCF and mEmerald-RAD21-N-18 (Addgene Plasmid #54248) for RAD21 ...
-
bioRxiv - Cell Biology 2024Quote: ... encoding a TEV cleavable N-terminal His6-tag (RRID: Addgene_228880 ...
-
bioRxiv - Cell Biology 2021Quote: ... gonads of young adult BOX428 animals were microinjected with 30 ng/μl Pelt-2::αGFP-NB::ZIF-1 and 2.5 ng/μl Pmyo-2::GFP (#Addgene 26347) as a co-injection marker ...
-
bioRxiv - Cancer Biology 2023Quote: ... shRNA 2 (shYAP1 #2) or scramble shRNA (shNC) were inserted into pLKO.1-TRC Cloning Vector (Addgene, 10878, RRID: Addgene_10878) following the manufacturer’s protocol and sequenced ...
-
bioRxiv - Cancer Biology 2023Quote: ... shRNA 2 (shYAP1 #2) or scramble shRNA (shNC) were inserted into pLKO.1-TRC Cloning Vector (Addgene, 10878, RRID: Addgene_10878) following the manufacturer’s protocol and sequenced ...
-
bioRxiv - Neuroscience 2022Quote: ... and AAV2-hSyn-mCherry (UNC vector core) (Figures 2, 6, & 7; Figure 2 – Figure supplement 1) or retrograde AAV-hSyn-DIO-eGFP (Addgene) and retrograde AAV-hSyn-mCherry (Addgene ...
-
bioRxiv - Developmental Biology 2024Quote: ... gRNAs 1 and 2 (Supplemental Table 2) were cloned into the pSpCas9n(BB)-2A-Puro (PX462) V2.0 plasmid (Addgene 62987) as described previously70 ...
-
bioRxiv - Neuroscience 2024Quote: ... Gi DREADD virus (n=25,13 males, 12 females: AAV8-hSyn-DIO-hM4Di-mCherry,≥ 1×101 3 vg/mL, Addgene; Watertown, MA, USA) was mixed with GAD1-cre to express inhibitory designer receptors in VP GABA neurons ...
-
bioRxiv - Molecular Biology 2024Quote: ... with HA-tag at the N-terminal and GFP-tag at the C-terminal were cloned in pEGFP-N3 expression vector (Addgene #6080-1) (Table S8 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... benthamiana U6 promoter (NbU6-1 Addgene#185623 and NbU6-2 Addgene#185624) (Supplementary Table S6) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... benthamiana U6 promoter (NbU6-1 Addgene#185623 and NbU6-2 Addgene#185624) (Supplementary Table S6) ...
-
bioRxiv - Cell Biology 2022Quote: ... CRISPR vector pX330A-1×2 was a gift from Takashi Yamamoto (Addgene plasmid # 58766 ...
-
bioRxiv - Neuroscience 2023Quote: ... doublefloxed.hChR2(H134R).EYFP.WPRE-HGHpA (diluted 1:2 with dPBS; Addgene number: 20298) was injected into auditory cortex as described above in ChAT-Cre animals ...
-
bioRxiv - Neuroscience 2023Quote: Burrhole injections of viral constructs [rAAV2/1&2.hSyn.SIO-eOPN3-mScarlet (Addgene 125713 diluted to 6 × 1012 viral genomes/mL ...