Labshake search
Citations for Addgene :
451 - 500 of 2738 citations for 1 Piperidineacetamide 4 2 benzothiazolyl N 4 4 morpholinyl phenyl 9ci since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... mEmerald-N-Wasp-C-18 and mEmerald-Coronin1B from Michael Davidson (Addgene plasmids #54199, 54050), pmCherry-C1-WIP from Anna Huttenlocher ...
-
bioRxiv - Cancer Biology 2020Quote: ... HPV16 E6 (p6661 MSCV-IP N-HA only 16E6 – Addgene plasmid # 42603 Dr. Peter Howley), HPV16 E7 (p6640 MSCV-P C-FlagHA 16E7-Kozak - Addgene plasmid # 35018 – Dr ...
-
bioRxiv - Neuroscience 2020Quote: ... AAV5-hsyn-DIO-rM3D(Gs)-mCherry (excitatory; titer: 1.3×1013 vg/mL; N=10 [Addgene, #50485 ...
-
bioRxiv - Cell Biology 2021Quote: The full length mouse SUMO2 fused to HA (N-terminus) from a plasmid (Addgene 48967) [67] were inserted in the retroviral transfer plasmid pCX4 Puro ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were transfected with 5 μg of mEmerald-Kinesin11-N-18 plasmid (Addgene number: 54137) 24 hours prior to imaging ...
-
bioRxiv - Cancer Biology 2022Quote: SK-N-DZ cells were transduced with lentiviral particles encoding LRP8 gRNAs (lentiCRISPRv2 blast, Addgene plasmid #98293 was a gift from Brett Stringer) ...
-
bioRxiv - Cell Biology 2022Quote: ... mEmerald Hc-SRC-N-18 (Src-eGFP here) was a gift from Michael Davidson (Addgene plasmid # 54118 ...
-
bioRxiv - Biophysics 2023Quote: ... or to the N-terminus of a glycosylphosphatidylinositol (GPI)-anchor (GPI-mEGFP, Addgene plasmid #182866) and were previously described [42 ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV1-EF1a-N-CretrcintG and AAV1-EF1a-C-CreintG were gifts from Connie Cepko (Addgene viral prep # 69570-AAV1 and 69571-AAV1 ...
-
bioRxiv - Developmental Biology 2024Quote: ... The pDEST-CMV-N-Tandem-mCherry-EGFP plasmid was a gift from Robin Ketteler (Addgene plasmid #123216 ...
-
bioRxiv - Immunology 2022Quote: ... We first cloned the N- and C-termini of NFAT5 isoform A synthetized by Addgene into a pMSGV retroviral vector ...
-
bioRxiv - Biochemistry 2023Quote: ... N-terminal or C-terminal heptahistidine (His7) tags were added using pQLinkH (Addgene plasmid 13667) or a modified derivative ...
-
bioRxiv - Neuroscience 2024Quote: ... each 15 cm dish was transfected with 27.1 μg of SAD B19-N (Addgene #32630), 13.9 μg of SAD B19-P (Addgene #32631) ...
-
bioRxiv - Bioengineering 2024Quote: ... Npu intein-split ABE constructs were cloned into N- and C-terminal AAV plasmids (Addgene plasmids 137177 and 137178 ...
-
bioRxiv - Bioengineering 2024Quote: ... Npu intein-split ABE constructs were cloned into N-and C-terminal AAV plasmids (Addgene plasmids 137177 and 137178 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Sequences (shPROX1-1: TGCTGTTGACAGTGAGCGCGAGGACCAAGATGTCATCTCATAGTGAAGCCACAGATGTATGAGATGAC ATCTTGGTCCTCATGCCTACTGCCTCGGA; shPROX1-2: TGCTGTTGACAGTGAGCGCCCCCGAGAAAGTTAC AGAGAATAGTGAAGCCACAGATGTATTCTCTGTAACTTTCTCGGGGATGCCTACTGCCTCGGA) were cloned into the LT3GEPIR backbone100 (Addgene; 111177) and used to generate lentiviral particles to transduce into organoids as described99 ...
-
bioRxiv - Cancer Biology 2023Quote: ... A CRISPR/dCas9 vector was constructed as follows: pX330A_dCas9-1×2 (Addgene, Watertown, MA; plasmid ID 63596) (20 ...
-
bioRxiv - Plant Biology 2023Quote: ... fw2.2-sgRNA-1 and fw2.2-sgRNA-2 were fused to the Arabidopsis AtU6-26 promoter (Addgene #46968) by digestion-ligation reaction in plCH47751 (Addgene #48002 ...
-
bioRxiv - Biochemistry 2020Quote: ... and inserted into UC Berkeley Macrolab vector 1GFP (KanR, N-terminal His6-GFP fusion; Addgene #29663). Plasmids were transformed into E ...
-
bioRxiv - Cell Biology 2022Quote: ... Constructs encoding the DFCP1 N-terminus were cloned into pET-His6-MBP-TEV-LIC (Addgene # 29708) and Rosetta2(DE3 ...
-
bioRxiv - Biochemistry 2022Quote: FUS SYQG LC containing a TEV cleavable N-terminal histidine tag (RP1B FUS LC, AddGene #127192), full-length FUS with an N-terminal histidine tag and maltose-binding protein fusion (pTHMT FUS 1-526 ...
-
bioRxiv - Cell Biology 2022Quote: ... MAC (BirA-Ha-Strep-tag II)-N was a gift from Markku Varjosalo (Addgene plasmid # 108078). FLAG-tagged TR-TUBE has been previously published (Yoshida et al. ...
-
bioRxiv - Genomics 2021Quote: ... vectors by replacing the Cas9 and puromycin N-acetyltransferase sequences in lentiCRISPR v2 plasmid (Addgene, 52961) with hygromycin B phosphotransferase and EGFP or mCherry sequences ...
-
bioRxiv - Biophysics 2021Quote: ... coli expression vector with an N-terminal 6xHis tag followed by an MBP tag (Addgene #29654) by ligation independent cloning (LIC) ...
-
bioRxiv - Neuroscience 2023Quote: ... Entry vectors were transferred into pDEST-CMV-N-EGFP (24) (Prof. Robin Ketteler, AddGene clone 122842) and/or pdcDNA-FlagMyc (B ...
-
The Hippo pathway terminal effector TAZ/WWTR1 mediates oxaliplatin sensitivity in colon cancer cellsbioRxiv - Cancer Biology 2023Quote: Murine Taz was expressed by transfecting cells with pEF-TAZ-N-Flag from Michael Yaffe (Addgene #19025 ...
-
bioRxiv - Cell Biology 2024Quote: ... For N-terminal tagging a repair donor plasmid consisting of mCherry2 (derived from Addgene plasmid # 72831), flanked by a total of 6X Flag repeat epitope tags was generated ...
-
bioRxiv - Neuroscience 2023Quote: ... or GFP and Synaptophysin-RFP cDNA (pRVdG-N-P-M-EGFP-SynPhRFP-L, Addgene plasmid #52483), and with these additional plasmids ...
-
bioRxiv - Cell Biology 2022Quote: Human PFKFB3 tagged with N-terminal GFP was cloned into the viral plasmid pWPXL (Addgene #12257). A PFKFB3 mutant (nuc-free PFKFB3 ...
-
bioRxiv - Genetics 2023Quote: ... Various Npu intein-split ABE constructs were cloned into N- and C-terminal AAV vectors (Addgene plasmids 137177 and 137178 ...
-
bioRxiv - Biophysics 2024Quote: ... in combination with pBV-Luc BDS-2 3x WT (pBDS-2) (BDS-2 3x WT (p53 binding site) was a gift from Bert Vogelstein (Addgene plasmid #16515 ...
-
bioRxiv - Cell Biology 2022Quote: ... CRISPR vector pX330A-1×2 was a gift from Takashi Yamamoto (Addgene plasmid # 58766 ; http://n2t.net/addgene:58766 ; RRID:Addgene_58766) (101) ...
-
bioRxiv - Neuroscience 2020Quote: ... from pBS-KS-attB2-SA(0/1/2)-T2A-LexA::QFAD-Hsp70 plasmids (Addgene #62947, #62948 and #62949) (Diao et al. ...
-
bioRxiv - Neuroscience 2021Quote: AAV1/2.hSyn-GFP particles were generated by co-transfection of HEK293T cells with AAV2/1 (Addgene 112862), AAV2/2 (Addgene 104963) ...
-
bioRxiv - Cell Biology 2020Quote: ... dlg-1::mCherry and ebp-2::egfp vectors were cloned using Gibson assembly and vector pJJR82 (Addgene #75027) (Gibson et al. ...
-
bioRxiv - Biochemistry 2023Quote: ... The SARS-CoV-2 Spike ectodomain Hexa-pro construction (Table 1) was a gift from Jason McLellan (Addgene # 154754 ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV2-EF1a-DIO-eNpHR3.0-EYFP-WPRE-pA (4.0 × 1012 vg/mL, 1:2 dilution, UNC vector core using Addgene plasmid #26972 ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV2/2 (Addgene 104963), adenovirus helper plasmid pAdDeltaF6 (Addgene 112867 ...
-
bioRxiv - Microbiology 2020Quote: ... The plentiCRISPRV.2 (Addgene) was digested with BsmBI and ligated with guide RNA sequences specific for IFNAR1 ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV2/2 (Addgene #104963), pAAV2/5 (Addgene #104964) ...
-
Cellular sialoglycans are differentially required for endosomal and cell-surface entry of SARS-CoV-2bioRxiv - Microbiology 2024Quote: ... psPAX-2 (Addgene #12260) was used as a packaging plasmid ...
-
bioRxiv - Biochemistry 2021Quote: ... GST-tag and MBP-tag were attached to its N- and C-terminus respectively (Addgene ID 169195). The cleavage at G//A resulted in 25 and 42 kDa products ...
-
bioRxiv - Biochemistry 2021Quote: ... P1-8 and Photobacterium damselae were cloned into pNIC28-Bsa4 (N-terminal polyhistidine tag; Addgene #26103 (60)) ...
-
bioRxiv - Biochemistry 2022Quote: AR-LBD (663-919) containing an N-terminal His-tag and encoded in pET15b plasmid (Addgene #89083) was expressed in Rosetta (DE3 ...
-
bioRxiv - Cell Biology 2023Quote: cDNA sequences encoding N- and C-terminal fragments of Venus were amplified from pCe-BiFC-VN173 (Addgene) and pCe-BiFC-VC155 (Addgene ...
-
bioRxiv - Cell Biology 2024Quote: ... CAPS-FLAG was created by Gateway cloning the CAPS gene into pDEST-N-terminal FLAG (Addgene #18700), providing expression of N-terminally FLAG-tagged CAPS control of the cmv-promoter ...
-
bioRxiv - Cell Biology 2023Quote: ... Cloning of Def16 sequence to pET plasmid containing an N-terminus Hisx6 tag and GFP (Addgene # 29663) was done by whole plasmid amplification using the indicated forward and reverse primers for GFP-Def16 (primers 1 and 2 ...
-
bioRxiv - Biophysics 2022Quote: ... Rat CaMKIIWT with an N-terminal EGFP pCAG-mEGFP-CaMKIIa was a gift from Ryohei Yasuda (Addgene plasmid # 127389 ...
-
bioRxiv - Cell Biology 2022Quote: ... The GFP-VASP (mEmerald-VASP-N-10) plasmid was a gift from Michael Davidson (Addgene plasmid 54297). The GFP-RIAM(1-666 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Digested gBlocks were ligated to digested pGEX-6p1-N-HA (gift from Andrew Jackson & Martin Reijns, Addgene plasmid # 119756 ...