Labshake search
Citations for Addgene :
3401 - 3450 of 4199 citations for 6H Dibenzo a g quinolizinium 5 8 13 13a tetrahydro 2 9 dihydroxy 3 10 dimethoxy 7 methyl 7S 13aS since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... 5’-GGG GGG GGC GGA ATT CTC AGT CTA TCT TTT CTT TCT GGA CCA GTC TGG GAG C-3’ and pmScarlet-C1 (gift from Dorus Gadella; Addgene plasmid # 85042 ...
-
bioRxiv - Molecular Biology 2019Quote: ... sgRNAs that target the 3′ end of the respective coding sequences were cloned into hSpCas9 plasmid (PX458, Addgene Plasmid #48138) (Ran et al ...
-
bioRxiv - Neuroscience 2020Quote: ... rv 5’-ATTTTAACTTGC-TATTTCTAGCTCTAAAACAACCATGTTCCG-TATTCAGATGCACCAGCCGGGAATCGAACC-3’) that were cloned with a single Gibson Assembly reaction in a pCFD6 (Addgene plasmid # 73915; RRID: Addgene_73915) vector [27] which was previously digested with BbsI restriction enzyme.
-
bioRxiv - Microbiology 2022Quote: C-terminal endogenous tagging of loci was performed in TgPRUΔKu80ΔHXGPRT by targeting the 3’UTR of ROCY1 with a specific gRNA cloned into the pUniversal-CAS9 plasmid (Addgene #52694) and then co-transfected with a homology repair cassette amplified from the pLIC-HXGPRT plasmid (as outlined in (Fox et al. ...
-
BTBD9 is a novel component of IGF signaling and regulates manganese-induced dopaminergic dysfunctionbioRxiv - Neuroscience 2021Quote: ... eft-3::hpo-9 or BTBD9 alone were co-injected into tm3719 strain with pG2M36 (myo-3::dsRed) and pBCN27-R4R3 (rpl-28::PuroR, Addgene), which were used as the selective markers for transformation ...
-
bioRxiv - Neuroscience 2019Quote: ... The intracellular solution also contained 50 µM of the red fluorescent dye AlexaFluo 594 and 3 plasmids with the following concentrations42: 100µg/µL pCAG-dsRed2 (Addgene #15777), 200 µg/µL pCMV-oG48 (Addgene 74288 ...
-
bioRxiv - Cancer Biology 2019Quote: ... SENP8) clonal Cas9 expressing BC-3 cells were transduced with lentiviral sgRNA vectors based on pLenti-guide puro (Addgene #52963)34 ...
-
bioRxiv - Synthetic Biology 2019Quote: All single guide RNAs were cloned in BbsI-linearized pCFD3-dU6:3 gRNA plasmid (a gift from Simon Bullock; Addgene plasmid # 49410 ...
-
bioRxiv - Developmental Biology 2020Quote: ... The CRISPR line robo1ΔWIRS was generated by cloning a guide targeting the WIRS motif into a pCFD3-dU6:3 backbone (Addgene, #49410) and sending positive clones to BestGene Inc ...
-
bioRxiv - Molecular Biology 2019Quote: ... was chosen to target the TIP5 locus on exon 3 three base pairs upstream of the ATG start codon and was cloned into pSpCas9(BB)-2A-GFP (PX458, Addgene). This plasmid was co-transfected with the HDR repair template plasmid containing the FLAG/HA inclusion flanked by 1kb homology arms into wild type ESCs at a molar ratio of 1:3 ...
-
bioRxiv - Immunology 2021Quote: ... Full length FOXN1 cDNA without a stop codon was cloned into vector backbones positioning at its C-terminus either a flag (pCSF107mT-GATEWAY-3’-FLAG, Addgene), myc (pCSF107mT-GATEWAY-3’-Myc tag ...
-
bioRxiv - Genetics 2019Quote: ... Only a single site upstream of the c(3)GccΔ1 deletion was selected (AAAGCTTTGTTGGCCTGTATTGG) and constructed into the pU6-BbsI-chiRNA guide RNA (gRNA) plasmid (Addgene 45946). Sense (CTTCGAAAGCTTTGTTGGCCTCTAT ...
-
bioRxiv - Cell Biology 2019Quote: ... The guide RNA sequences used to generate TDP43 KO cell lines (summarized in Supplemental Table 3) were annealed and cloned into the BbsI site of pSpCas9(BB)-2A-Puro vector (px459, Feng Zhang, Addgene). Sub-confluent Hela cells were transfected with 1µg of px459 vector using FuGENE 6 (Promega) ...
-
bioRxiv - Cell Biology 2021Quote: Using the Neon transfection system pre-set program #16 (1400V, 20ms, 3 pulses) plasmids used for reprogramming (available from Addgene) were EN2L ...
-
bioRxiv - Developmental Biology 2021Quote: ... gRNAs targeting exon 3 of the zebrafish atg13 orthologue (Ensembl: ENSDART00000052324.6; zgc:63526) were cloned into the pT7-gRNA plasmid (Addgene #46759) and generated according to Jao et al ...
-
bioRxiv - Biophysics 2019Quote: ... the in-frame GFP fusion from pUAST-GFP-Clc [3] was excised with an EcoRI/BglII digest and replaced with mEmerald (Addgene), PCR amplified with primers GGAATTCCACCATGGTGAGCAAGGGCGAGG and CGAGATCTGAGTCCGGACTTGTACAGCTCGTCCATG (the EcoRI and BglII sites in the primers are underlined) ...
-
bioRxiv - Cell Biology 2022Quote: The sgRNA oligomers for SLC25A46 targeting exon 1 and 3 were annealed and inserted into plasmid pSpCas9(BB)-2A-Puro (PX459) V2.0 from Addgene (62988) via combined ligation (T7 ligase NEB).
-
bioRxiv - Cell Biology 2022Quote: ... The sgRNA expression vectors were generated by cloning appropriate DNA oligonucleotides (Suppl. Table 3) in the BbsI restriction sites of pX459 (#62988, Addgene). An empty pX459 vector was used to generate matching negative control cell lines ...
-
bioRxiv - Neuroscience 2022Quote: Virus expression: pulled glass pipettes were used to inject 500nL of AAV5-mDIx-Chr2-mCherry-Fishell-3 (plasmid no.83898, Addgene, USA ...
-
bioRxiv - Neuroscience 2024Quote: ... the ReaChR virus was co-injected unilaterally into the LC with AAV9-hSyn-FLEX-jGCaMP8m (3 × 1013 gc/mL, 162378-AAV9 from Addgene) or with AAV9-hSyn-GRABNEm (2-9 × 1013 gc/mL ...
-
bioRxiv - Genomics 2024Quote: ... and the top 3 sgRNAs were individually cloned into single sgRNA expression vectors with direct capture cs1 sequences (Addgene # 122238)10 using restriction digest (BstXI and BlpI ...
-
bioRxiv - Developmental Biology 2024Quote: ... MegaGate was utilized to insert ORFs into the final PB-cT2G-cERP2 3’ UTR barcode-modified expression vectors (Addgene 175503). Three unique barcodes were selected for each ORF with an average hamming distance of six ...
-
bioRxiv - Genetics 2023Quote: ... 1 × 106 iPS cells were seeded at a density of 100,000 cells/cm2 and transfected with 3 μg pC13N-dCas9-BFP-KRAB (Addgene, 127968), 0.375 μg pZT-C13-L1 (Addgene ...
-
bioRxiv - Molecular Biology 2023Quote: ... The sequence of a single guide RNA (sgRNA) specifically targeting the 3’ end of TGRH88_003980_t1 was integrated into pSAG1::CAS9-GFPU6::sgUPRT (Addgene plasmid # 54467) using the Q5-site directed mutagenesis kit (NEB) ...
-
bioRxiv - Genomics 2023Quote: ... we designed a gRNA that targets the 3’ end of the SOX2 stop codon (Supplementary Table S25, Addgene plasmid #163752). We then amplified ∼800 bp homology arms upstream and downstream of the gRNA target sequence using high-fidelity Phusion Polymerase ...
-
bioRxiv - Cell Biology 2023Quote: ... embryos were electroporated at DIV0 just before plating with 3 µg of the plasmid control encoding for Td-tomato alone (pCAG td Tomato, Addgene) or 3 µg of plasmid encoding for Cre-recombinase and reporter gene Td-tomato (pCAG td Tomato-Ires-Cre ...
-
bioRxiv - Molecular Biology 2023Quote: - recombinant pGEX-4T-3-P53: The human-p53 cDNA was previously cloned in the EcoRI site of pGEX-4T3 (Addgene_79149) under the lac-trp hybrid promoter that is inducible by IPTG ...
-
bioRxiv - Cell Biology 2023Quote: ... The RAD52KO cell line was generated from the RAD52WT line by CRISPR-Cas9-mediated deletion of the 1.1kb region between exons 3 and 4 using guide RNAs sg1 and sg2 cloned into px330 (Addgene #42230) as previously described (Kelso et al ...
-
bioRxiv - Cell Biology 2023Quote: eGFP with three perfect miR430 target sites in its 3’UTR (eGFP-3xPT-miR430b) was inserted in the pCS2+ plasmid (Addgene) as described before 24 ...
-
bioRxiv - Biochemistry 2023Quote: The 6xHis-SUMO-14-3-3ζ construct used in this work (kind gift of prof. B.M. Burmann) was derived from GST-14-3-3ζ (Addgene #13278)26 ...
-
bioRxiv - Biophysics 2023Quote: Fusion constructs with pTREtight2 vectors were co-transfected with reverse tetracycline-controlled transactivator 3 (pLenti CMV rtTA3 Hygro (w785-1)) plasmid (Addgene) in the presence of doxycycline (Clontech) ...
-
bioRxiv - Neuroscience 2023Quote: ... we inserted a barcode sequence consisting of 20 random nucleotides in the 3’ untranslated region of the nucleoprotein gene in pRVΔG-4mCherry (Addgene #52488) (SAD B19 strain ...
-
bioRxiv - Neuroscience 2024Quote: ... For the VIP silencing experiments (Figure 7H) 3 VIP-Cre mice were injected with a mixture of viruses expressing GcaMP7f (pGP-AAV9-syn-jGCaMP7f-WPRE, Addgene) and Cre-dependent ArchT (pAAV-FLEX-ArchT-tdTomato (AAV5) ...
-
bioRxiv - Cell Biology 2024Quote: ... The RNAi clone that targets the 3’UTR of cdc-42 was generated through amplification of genomic cdc-42 3’UTR (Fwd: gaagatctgaacgtcttccttgtctccatgt; Rev: ggggtaccacgtaacggtgtatccggac) and insertion into the L4440 plasmid (#1654 Addgene). Control bacteria is transformed with empty L4440 vector (#1654 Addgene).
-
bioRxiv - Cell Biology 2024Quote: ... and 3 µg of mouse Lamin B1 or Lamin B2 or Lamin B3 plasmids conjugated with myc-tag (pCS2-MT, Addgene). Cells were incubated for 48h in a DMEM cultivation medium (Gibco ...
-
bioRxiv - Cell Biology 2024Quote: The monoclonal SK-N-DZ SCLYKO cell line was transduced with Toronto KnockOut (TKO) CRISPR Library - Version 3 (Addgene, 90294) at MOI of 0.3 ...
-
bioRxiv - Cell Biology 2022Quote: ... A Rac1 specific gRNA 5’ ACACTTGATGGCCTGCATCA was cloned into plasmid pX330-BbsI-PITCh (Addgene plasmid #127875) and transfected along with pN-PITCh-GFP-Rac1 into HeLa cells using JetPrime (Polyplus ...
-
bioRxiv - Cell Biology 2021Quote: ... cDNA encoding TNKS ARC1-5 (aa 174-985) was subcloned by PCR into pFLAG-CMV2 (Addgene.org). All vectors subcloned using PCR were sequenced on both strands for verification.
-
bioRxiv - Cell Biology 2021Quote: ... antisense: 5’-aaacTACGCATTGGACGGCTCCTCc) was cloned into pSpCas9 (BB)-2A-mCherry created by PX459 V2.0 (Addgene #62988). This plasmid was then transfected into immortalized STING-knockout MEFs (Mukai et al. ...
-
bioRxiv - Cancer Biology 2022Quote: ... SKOR1-shRes-WT and -Y234F were then recombined into pLenti CMV-GFP (658-5) (Addgene; 17448). For transduction of the above mentioned constructs ...
-
bioRxiv - Neuroscience 2022Quote: ... [14] and low-titer Cre (AAV9-hSyn-Cre-WPRE-hGH; Addgene #105553, MOI = 5×103 vg) AAVs on DIV 7 ...
-
bioRxiv - Cancer Biology 2019Quote: ... HCT116-Dnmt1Δ3-5 cells were transfected with pcDNA3 vector containing WT full length DNMT1 (36939, AddGene) and empty pcDNA3 vector as a transfection control (10792 ...
-
bioRxiv - Cell Biology 2020Quote: ... Blunt-end repaired RhoBAST16 was cloned into 5′ UTR CGG 99× FMR1-EGFP (Addgene, plasmid #63091) which was digested with the NotI enzyme ...
-
bioRxiv - Molecular Biology 2021Quote: ... an XhoI restriction site was generated 5’ of the GFP-gene in pDRGFP (Addgene plasmid #26475)23 and the GFP-gene was replaced by the eBFP1.2 gene using the XhoI/NotI restriction sites ...
-
bioRxiv - Neuroscience 2022Quote: ... mice were infused with diluted (1:5) or undiluted virus pAAV5-CAMKIIa-(hChR2- H134R)-eYFP (Addgene-ChR2 titre ...
-
bioRxiv - Physiology 2022Quote: ... The control virus AAV2/5-hSyn-DIOmCherry was ordered from Penn Vector Core (Addgene plasmid 50459). Animals were allowed to recover from stereotaxic surgery for a minimum of 21 days before initiation of any experiments ...
-
bioRxiv - Neuroscience 2023Quote: ... neurons were transduced with AAV9-Syn (5 x 109 gc per well) encoding jGCaMP8s (AddGene 162374) or CaBLAM (in house prep) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and guide cassettes were assembled into pGGG-M along with end linker pELE-5 (Addgene #48020). The resulting plasmid was named pGGG-TaDMC1-D and sequenced to ensure authenticity before transferring to Agrobacterium.
-
bioRxiv - Cancer Biology 2023Quote: The sgRNAs specific for 5’ to the region of interest were cloned in pLentiCRISPRv2 (Addgene, #52961). sgRNAs corresponding to 3’ to the region of interest was cloned in pDecko-mCherry (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: ... or eYFP alone as a control (AAV-EF1a-DIO-eYFP; serotype 5; Dr. Karl Deisseroth; RRID:Addgene_27056).