Labshake search
Citations for Addgene :
3651 - 3700 of 4199 citations for 6H Dibenzo a g quinolizinium 5 8 13 13a tetrahydro 2 9 dihydroxy 3 10 dimethoxy 7 methyl 7S 13aS since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... 2 µL of the adeno-associated viral vector rAAV9/1.EF1a.DIO.hChR2(H134R)-eYFP.WPRE.hGH (Addgene, #20298-AAV9) was dyed with 0.3 µL fast green (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2022Quote: ... All RVdG-CVS-N2c plasmids presented in this study are available from Addgene (Supplementary table 2).
-
bioRxiv - Biochemistry 2022Quote: ... pBBR1MCS-2 was a gift from Kenneth Peterson (Addgene plasmid # 85168; http://n2t.net/addgene:85168; RRID:Addgene_85168). The resulting plasmids were then transformed into Shewanella using electroporation (56) ...
-
bioRxiv - Neuroscience 2021Quote: ... The pCMV14-3X-Flag-SARS-CoV-2 S plasmid was a gift from Zhaohui Qian (Addgene plasmid # 145780 ...
-
bioRxiv - Microbiology 2021Quote: ... solution containing 2 μg of TF-responsive reporters driving Firefly luciferase (pGL3-3xAP1-luciferase (Addgene, 40342), pGL3-NF-κB-luciferase (Promega) ...
-
bioRxiv - Microbiology 2021Quote: ... pBMTL-2 was a gift from Ryan Gill (Addgene plasmid # 22812; http://n2t.net/addgene:22812; RRID:Addgene_22812). All amplification reactions were performed using Q5 high-fidelity DNA polymerase (New England Biolabs ...
-
bioRxiv - Cell Biology 2022Quote: ... Knock-ins were created by injecting pBS-KS-attB1-2 (Addgene#61255; (Zhang et al, 2014)) containing HA-tagged dAuxWT or HA-tagged dAuxRG (the R1119G mutation ...
-
bioRxiv - Neuroscience 2020Quote: ... pAAV-mDlx-mCherry and pAAV-mDlx-tdTomato were generated using pAAV-mDlx-GCaMP6f-Fishell-2 (Addgene plasmid #83899 ...
-
bioRxiv - Immunology 2021Quote: ... Greene) and pCMV14-3X-Flag-SARS-CoV-2 S (a gift from Zhaohui Qian, Addgene #145780) at 1:0.5:2 molar ratio using Lipofectamine™ 2000 (0.6 ul per 1 ug DNA ...
-
bioRxiv - Immunology 2021Quote: ... Guide 1 (TGTTGGGGAACATATGACAC) and Guide 2 (AAGGAAAAATTCAAACAAGG) sequences were cloned into lentiGuide-puro plasmid (Addgene, #52963), transformed in Stbl3 bacteria (Invitrogen ...
-
bioRxiv - Immunology 2020Quote: ... 2 × 104 HEK293T target cells transfected with 500 ng of a human ACE2 expression plasmid (Addgene) were seeded in a white flat-bottom 96-well plate one day prior to the assays ...
-
bioRxiv - Microbiology 2024Quote: Mammalian expression vectors used were pcDNA3.1-Ha-Dynamin 2.WT (gift of S. Schmid; Addgene 34684), pcDNA3.1-Ha-Dynamin 2.K44A (gift of S ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 µL of the adeno-associated viral vector rAAV9/1.EF1a.DIO.hChR2(H134R)-eYFP.WPRE.hGH (Addgene, #20298-AAV9) was dyed with 0.3 µL fast green (Sigma-Aldrich ...
-
bioRxiv - Biophysics 2023Quote: Dendra-2 EEA1 was generated by replacing TagRFP-T in RagRFP-T EEA1 (Addgene plasmid #42635) at cloning sites AgeI and XhoI ...
-
bioRxiv - Biochemistry 2023Quote: ... SARS-CoV-2 Mac1 without CFP-tag was cloned and expressed from pNH-TrxT (Addgene #173084).
-
bioRxiv - Genetics 2023Quote: ... All the plasmids developed in this work (Table 2) will be available from Addgene (Massachusetts, USA) once the manuscript is accepted for publication.
-
bioRxiv - Immunology 2023Quote: ... SARS-CoV-2 whole spike protein HexaPro was a gift from Jason McLellan (Addgene plasmid # 154754). SARS-CoV-2 HexaPro was expressed in Expi293F cells and purified with Ni-NTA resin followed by size exclusion as described previously [61] ...
-
bioRxiv - Cancer Biology 2022Quote: ... Oligonucleotides were annealed and cloned in BsmBI–digested lentiCRISPRv.2-puro plasmid (catalogue no. 52961; Addgene). Lentiviral particles for cloned lentiCRISPRv.2 were generated by transfecting human embryonic kidney (HEK ...
-
bioRxiv - Genetics 2023Quote: pHarvester was generated using pCFD5-gRNA#1&2 and pnos-Cas9-nos plasmids (Addgene no: 62208). Briefly ...
-
bioRxiv - Neuroscience 2023Quote: Heterozygous ChAT-Cre mice were bilaterally injected with 1.0 µL of pAAV.Syn.Flex.GCaMP6s.WPRE.SV40 (diluted 1:2 in dPBS; Addgene: 100845-AAV5) in basal forebrain (AP ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV2/2-hsyn-DIO-hM4D(Gi)-mCherry was obtained from Addgene (plasmid #44362, 4.6x1012 GC/ml). For optogenetic activation ...
-
bioRxiv - Molecular Biology 2024Quote: ... nsp1 coding sequences were amplified by PCR from pDONR207 SARS-CoV-2 nsp1 (WT, Addgene #141255), pDONR207 SARS-CoV-2 nsp1 Delta RC (M1 ...
-
bioRxiv - Microbiology 2019Quote: ... We introduced a single guide RNA (gRNA) targeting the 3’ region of the TgApiAT1 locus into the vector pSAG1::Cas9-U6::sgUPRT (Addgene plasmid # 54467; [34]) using Q5 site-directed mutagenesis (New England Biolabs ...
-
bioRxiv - Genetics 2021Quote: ... Cas9 and dCas-VP64 Calu-3 knock-in lines were then transduced with Brunello and Calabrese Set A libraries (Addgene #73179 and #92379) as appropriate ...
-
bioRxiv - Microbiology 2020Quote: ... containing 40bp of the 5’ end of cobK to a second 923-bp PCR-generated fragment (FR2) containing 107bp of the 3’ end of cobK in a three-way ligation reaction with p2NIL backbone (Addgene plasmid #20188; (46)) ...
-
bioRxiv - Neuroscience 2024Quote: The shRNA construct for mouse aldolase A was generated using oligos directed towards the 3’UTR of Aldoa (GCCCACTGCCAATAAACAACT) and control scrambled shRNA (CCGCAGGTATGCACGCGT) and cloned into the pLKO.1 cloning vector (Addgene Cat# 10878, RRID:Addgene_10878) and pCGLH vector for lentivirus and in utero electroporation experiments ...
-
bioRxiv - Neuroscience 2024Quote: ... and 80-100nl of either AAV5-hSyn-hChR2(H134R)-EYFP (UNC Vector core) or pAAV9-mDlx-ChR2-mCherry-Fishell-3 (Addgene viral prep # 83898) was injected into the right GPi or SNr ...
-
bioRxiv - Neuroscience 2024Quote: ... DREADD+ group) was bilaterally injected in the dDG with pAAV5-CaMKIIa-hM4D(Gi)-mCherry (virus titer ≥ 3×1012 vg/ml, Addgene, North Carolina, USA). Inhibitory DREADDs are activated by the artificial ligand clozapine-N-oxide (CNO ...
-
bioRxiv - Neuroscience 2024Quote: ... 0.6-0.8 uL of a 1:1 mixture of GAD1-cre and mCherry virus (AAV8-hSyn-DIO-mCherry, ≥ 1×101 3 vg/mL; Addgene, Watertown, MA, USA) was injected bilaterally into VP ...
-
bioRxiv - Genetics 2024Quote: ... individual single and 3-plex crRNA constructs were cloned into the human U6 promoter-driven expression vector pRG212 (Addgene 149722, originally from 29). Library1 ...
-
bioRxiv - Cell Biology 2020Quote: P4M-GFP and mApple-Talin-N-10 were obtained from Addgene (51469 and 54951 respectively). FAPP-GFP was a gift from Tamas Balla ...
-
bioRxiv - Neuroscience 2020Quote: ... All transfections contained mCherry-CD9-10 (250 ng, was a gift from Michael Davidson; Addgene plasmid #55013 ...
-
bioRxiv - Neuroscience 2020Quote: ... AAV5-hsyn-DIO-rM3D(Gs)-mCherry (excitatory; titer: 1.3×1013 vg/mL; N=10 [Addgene, #50485 ...
-
bioRxiv - Neuroscience 2022Quote: pAAV-CAG-tdTomato (titer ≥ 1×10¹³ vg/mL) was a gift from Edward Boyden (Addgene viral prep #59462-AAV9 ...
-
bioRxiv - Biochemistry 2021Quote: ... 10 μg of plasmid (pBABE-puro, Addgene #1764 or pBabe-puro Ras V12, Addgene #1768) was added to the FuGENE + OPTI-MEM ...
-
bioRxiv - Microbiology 2020Quote: ... HEK293T on 10-mm coverglasses were transfected with 200 ng of pcDNA3.1-hACE2 (Addgene, #145033) 24 hours later ...
-
bioRxiv - Molecular Biology 2021Quote: ... The pSFFV_mNG2(11)1-10 plasmid was a gift from Bo Huang (Addgene plasmid # 82610) (Feng et al. ...
-
bioRxiv - Neuroscience 2024Quote: ... we injected a mix of AAV1.Syn.jGCaMP7f (Addgene 104488; dilution 1:10 ∼ 1x1013 GC/mL) and AAV1.Syn.Flex.tdTomato (Addgene 28306 ...
-
bioRxiv - Immunology 2023Quote: ... whereas mCherry1-10-RNase L was inserted into pLenti-PGK-PuromycinR plasmid (Addgene: Plasmid #19070). The mRuby-OAS3 CDS and mRuby2 were amplified via PCR and primers (Supplemental table 1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Injection cocktails contained 10 µg pCMV(CAT)T7-SB100 (gift from Zsuzsanna Izsvak; Addgene # 34879); 25 µg pSBbi-Myr-Akt-HA and 25 µg pSBbi-eGFP-IRES-V5-YAP5SA/ pSBbi-cJUN-WT-IRES-V5-YAP5SA/ pSBbi-cJUN-M14-IRES-V5-YAP5SA.
-
bioRxiv - Molecular Biology 2023Quote: ... 1000k pelleted hiPSCs were mixed with 1 μL 10 μM SP-dCas9-VPR (Addgene, 63798), 9 μL Buffer R2 (STEMCELL Technologies ...
-
bioRxiv - Neuroscience 2024Quote: ... mice were injected in LHA with AAV5-hSyn-DIO-eGFP (1*10^12vc/ml; Addgene) and co-injected with rAAV5-ORXpr1-3TdTomato (1*10^12 gc/ml ...
-
bioRxiv - Neuroscience 2024Quote: ... DV - 3.8) with 200 nL AAV9.EF1a.dflox.hChR2(H134R).mCherry.WPRE.HGH (1×10^12 pp/mL, Addgene). For subjects in cohort 1 (n=2) ...
-
bioRxiv - Developmental Biology 2020Quote: The zebrafish gfap promoter 51 was derived from the Addgene plasmid: pEGFP-gfap(Intron1/5’/Exon1-zebrafish) (Addgene, #39761) and lssmKate2 65 was derived from the Addgene plasmid ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells settled to the bottom of the well for 5 minutes at room temperature and then 0.25 μL of F-OKMS lentiviral mix (1:1 of Addgene plasmids 51543 ...
-
bioRxiv - Bioengineering 2022Quote: ... and LT1 (305 μL) was combined with a DNA mixture of the packaging plasmid pCMV_VSVG (Addgene 8454, 5 μg), psPAX2 (Addgene 12260 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Addgene plasmid # 12456) and 5 ng of Renilla luciferase control plasmid (a gift from David Bartel; Addgene plasmid # 12179) in each well ...
-
bioRxiv - Cell Biology 2022Quote: ... The lentiviral particles of shZDHHC5 (target sequence 5’CCCAGTTACTAACTACGGAAA3’ in pLKO.1 vector) and empty pLKO.1 (Addgene, 8453) were packaged in HEK293T cells and used to transduce PCDH7-GFP-BAC cells ...
-
Loss of TREM2 reduces hyperactivation of progranulin deficient microglia but not lysosomal pathologybioRxiv - Neuroscience 2021Quote: ... and 5 mg sgRNA cloned into the BsmBI restriction site of the MLM3636 plasmid (gift from Keith Joung, Addgene plasmid #43860 ...
-
bioRxiv - Cell Biology 2021Quote: Embryonic fibroblasts were generated from RHBDL4 WT and RHBDL4 KO E14.5 embryos and immortalized using lentiviral transduction of SV40 virus large T antigen (Ef1a_Large T-antigen_Ires_Puro, Addgene plasmid 18922), as described by Christova et al ...