Labshake search
Citations for Addgene :
3151 - 3200 of 10000+ citations for Human GSDMC shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2022Quote: ... and 7.5μg encoding for a lentiviral packaging plasmid (psPAX2 was a gift from Didier Trono - Addgene plasmid # 12260). Media was exchanged after 12 hours and VLPs harvested after 24 and 48 hours and enriched fiftyfold using LentiX concentrator according to the protocol provided by the manufacturer (Takara).
-
bioRxiv - Biochemistry 2023Quote: ... The pVSV-G plasmid was a gift from Akitsu Hotta (Addgene plasmid #138479; http://n2t.net/addgene:138479; RRID:Addgene_138479) (46) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Respective oligonucleotides were ordered from IDT and then cloned into the sgRNA delivery LRG plasmid (Addgene Plasmid #65656) using a BsmBI digestion.
-
bioRxiv - Biophysics 2023Quote: ... The pT7-7 aSyn C141 plasmid was a gift from Gabriele Kaminski Schierle (Addgene plasmid #108866; RRID: Addgene_108866). After lysis with boiling ...
-
bioRxiv - Developmental Biology 2023Quote: ... The guide sequence GGCTGAGAACAGCAGAGTAT was cloned into the BsmBI sites of the pT7-gRNA plasmid (Addgene plasmid 46759). Cas9 mRNA was generated from pCS2-nCas9n87 using the mMACHINE T7 ULTRA kit (Ambion ...
-
bioRxiv - Biochemistry 2023Quote: The GFP-UBR5 plasmid was a gift from Darren Saunders (Addgene plasmid #52050 ;http://n2t.net/addgene:52050 ; RRID:Addgene_52050) 75 and was recloned into a pEG-vector to enable its recombinant expression in HEK293 suspension cells using the BacMam-system ...
-
bioRxiv - Biochemistry 2023Quote: The pWS series of plasmids were gift from Tom Ellis (Addgene plasmid # 90516; http://n2t.net/addgene:90516; RRID:Addgene_90516) (Supplementary table 2) ...
-
bioRxiv - Cell Biology 2023Quote: ... The test wells were transfected with pHBx and control was transfected with GFP expressing plasmid (Plasmid #27082, Addgene). After three days post transfection transfected cells were treated with low dose puromycin (0.5 μg/ml ...
-
bioRxiv - Synthetic Biology 2023Quote: ... a modified version of plasmid pSR58.6 (a gift from Jeffrey Tabor, Addgene plasmid # 63176; http://n2t.net/addgene:63176; RRID:Addgene 63176) [19] added with the sponge from plasmid pLPT145 (a gift from Johan Paulsson ...
-
bioRxiv - Microbiology 2023Quote: ... with plasmids pCMV-VSV-G (a gift from Bob Weinberg Addgene plasmid # 8454 ; http://n2t.net/addgene:8454 ; RRID:Addgene_8454), BaEVRLess (gifted by Els Verhoeyen ...
-
bioRxiv - Molecular Biology 2023Quote: “CircRNA Mini” expression plasmids (herein also abbreviated to “mc”) were derived from pcDNA3.1(+) CircRNA Mini Vector (Addgene plasmid #60648; RRID:Addgene_60648). Exon sequences ...
-
bioRxiv - Cell Biology 2023Quote: ... recombinant DNA constructs cloned in lentiviral plasmids described above were co-transfected with packaging and envelope plasmids psPAX2 (gift from Didier Trono (Addgene plasmid # 12260; http://n2t.net/addgene:12260; RRID:Addgene_12260)) and pMD2.G (gift from Didier Trono (Addgene plasmid # 12259 ...
-
bioRxiv - Cell Biology 2023Quote: ... in HEK 293T cells (ATCC, VA) using 3rd generation lentiviral packaging plasmids pMDLg/pRRE (Addgene Inc., Plasmid 12251) and pRSV-RV (Addgene Inc. ...
-
bioRxiv - Cancer Biology 2023Quote: ... Lentivirus was generated by transfecting the PIKFYVE-containing plasmid with the packaging plasmids pMD2.G and psPAX2 (Addgene 12259 and 12260 ...
-
bioRxiv - Microbiology 2023Quote: The pX330 plasmid has been described previously (Cong et al. 2013) and was purchased from Addgene (plasmid 42230). The sequences coding for appropriate guide RNA were synthesised as two complementary dioxynucleotides ...
-
bioRxiv - Cell Biology 2023Quote: ... The plasmid encoding NPM1-mEGFP was a gift from the Allen Institute for Cell Science (Addgene plasmid # 109122). The sgRNA was synthesized by Synthego with modifications using the protospacer sequence UCCAGGCUAUUCAAGAUCUC (Wienert ...
-
bioRxiv - Genetics 2024Quote: ... is a functional plasmid that was used as a basis for the recombination experiments (plasmid available at Addgene). Two modifications of this plasmid—a truncation to create a 5758bp plasmid p-att-ef1a-MS2-RecT-dCas9-BSD-truncated and an extension to create a 13942bp plasmid p-att-ef1a-MS2-RecT-dCas9-BSD-extended —were used for recombination experiments but are not intended to be functional for genome editing ...
-
bioRxiv - Cell Biology 2024Quote: The plasmid EF1a-mito-dsRED2 was a gift from Thomas Schwarz (Addgene plasmid # 174541; http://n2t.net/addgene:174541; RRID:Addgene_174541). It contains a Flex-Switch-MitoDsRed construct under the transcriptional control of the EF-1α promoter ...
-
bioRxiv - Cancer Biology 2024Quote: ... The pCDNA3mycIRESGFP plasmid was created by introducing the BamHI-XhoI fragment of pWZL Blast myc (Addgene plasmid #10674) containing the c-Myc cDNA in BamHI-XhoI restricted pcDNA3.1(+ ...
-
bioRxiv - Biophysics 2024Quote: Haspin plasmid construct (GSG2) was a gift from Nicola Burgess-Brown (Addgene plasmid # 38915; http://n2t.net/addgene:38915; RRID:Addgene_38915). This construct was used to create Haspin mutant constructs using around-the-horn mutagenesis ...
-
bioRxiv - Genomics 2024Quote: ... pBL-TRP1-hsvTKCO-hENT1CO and pBL-AUR1C-hsvTKCO-hENT1CO plasmids are derivatives of p403-BrdU-Inc (Addgene plasmid # 71789; http://n2t.net/addgene:71789; RRID:Addgene_71789), p404-BrdU-Inc (Addgene plasmid # 71790 ...
-
bioRxiv - Molecular Biology 2024Quote: ... and the HDR donor plasmid derived from Mouse 5’ Npm1-AID-GFP-PuroR plasmid (a gift from Mark Groudine, Addgene plasmid #127899 ;http://n2t.net/addgene:127899; RRID:Addgene_127899) in which AID-GFP sequences were replaced with FLAG-HA or FKBP sequence (synthesized from IDT) ...
-
bioRxiv - Molecular Biology 2024Quote: ... and the lentiviral packaging plasmid pCMV-VSV-G a gift from Bob Weinberg (Addgene plasmid #8454; http://n2t.net/addgene:8454; RRID:Addgene_8454) (Stewart et al. ...
-
bioRxiv - Molecular Biology 2024Quote: ... transfections were performed using 500 ng psPAX2 (Gag-Pol) plasmid (Addgene plasmid 12260; http://n2t.net/addgene:12260; RRID:Addgene_12260), 500 ng mini-genome plasmid and 100 ng pCMV2-VSVG plasmid88 in 6-well clusters ...
-
bioRxiv - Biochemistry 2024Quote: ... cells were transfected 24h after seeding with mammalian expression plasmids to visualize Golgi (EYFP-Golgi7, Addgene plasmids # 56590), using JetPRIME transfection reagent (Polyplus transfection ...
-
bioRxiv - Systems Biology 2024Quote: ... All mutual repression circuits were obtained from the pECJ3 plasmid (gift from Dr. James Collins, Addgene plasmid # 75465)21 and harbored in a plasmid with a ColE1 origin ...
-
bioRxiv - Microbiology 2024Quote: ... PCR was performed using a plasmid VCP (wt)-EGFP gifted from Nico Dantuma (Addgene plasmid # 23971, http://n2t.net/addgene:23971; RRID:Addgene_23971) (72) ...
-
bioRxiv - Immunology 2024Quote: ... whereby the pBAD-mTagBFP2 plasmid was a gift from Vladislav Verkhusha (Addgene plasmid no. 34632 ; http://n2t.net/addgene:34632 ; RRID:Addgene_34632) (Subach et al. ...
-
bioRxiv - Molecular Biology 2024Quote: ... Kozak sequence was added to RCaMP1h by PCR using RCaMP1h cDNA from pRSET-RCaMP1h plasmid (Addgene plasmid #42874) as the template ...
-
bioRxiv - Cancer Biology 2022Quote: ... encoding human KDM6A with HA tag and pCS2-UTX-F-MT2 (40619) encoding enzyme-dead human KDM6A were purchased from Addgene. The HR and NHEJ reporter plasmids were kind gifts from Tomasz Skorski (61) ...
-
bioRxiv - Biophysics 2020Quote: ... pEGFP-yap-C3-hYAP1 (Addgene, plasmid #17843) (Basu et al. ...
-
bioRxiv - Cancer Biology 2021Quote: ... and envelope plasmid pMD2.G (12259, Addgene). Media was changed 24 hours post-transfection and virus was harvested 72 hours post-transfection ...
-
bioRxiv - Cancer Biology 2021Quote: ... pQCXIH-Myc-YAP-5SA (Addgene plasmid, #33093)(Zhao et al. ...
-
bioRxiv - Cancer Biology 2021Quote: ... LentiCRISPRv2 plasmid was obtained from Addgene (addgene.org). Guide sequences targeting LZTR1 were designed using CHOPCHOP (https://chopchop.cbu.uib.no/ ...
-
bioRxiv - Molecular Biology 2020Quote: ... pcDNA4/TO-ORF31-2xStrep (Addgene plasmid #129744), pcDNA4/TO-2xStrep-ORF34 (Addgene plasmid #120376 ...
-
bioRxiv - Developmental Biology 2021Quote: ... or pLenti-Cas9 plasmids (obtained from Addgene)(Ran et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... pPD118.33 (Pmyo-2∷GFP) (Addgene plasmid #1596) at 5 ng/μl and pBSKS (Stratagene ...
-
Polo-like kinase 1 independently controls microtubule-nucleating capacity and size of the centrosomebioRxiv - Cell Biology 2020Quote: ... The empty 5Myc plasmid (CS2P, Addgene #17095) or 3FLAG plasmid (p3XFLAG-CMV™-7.1 ...
-
bioRxiv - Microbiology 2021Quote: Plasmid pIRES-EGFP-puro (Addgene, 45567-DNA.cg) was digested with BstXI (NEB ...
-
bioRxiv - Genetics 2021Quote: ... The pGRB2.0 plasmid was purchased from Addgene. Standard ...
-
bioRxiv - Genetics 2021Quote: ... Our donor plasmid p5154 (Addgene reference 175390) is intended for small-medium sized donor DNAs (<15kb ...
-
bioRxiv - Developmental Biology 2021Quote: ... The plasmids for Vsp1-C301S (Addgene, 51882), Vsp1-R152Q-GFP (Addgene ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5ug pMD2.G (Addgene plasmid #12259 - envelope). Transfection media was incubated for 15-16 hours ...
-
bioRxiv - Molecular Biology 2021Quote: ... pSH-EFIRES-P-AtAFB2 (Addgene plasmid #129715)27 ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2.25 µg psPAX2 (Addgene plasmid no. 12260) for lentivirus or pUMVC (Addgene plasmid no ...
-
bioRxiv - Microbiology 2020Quote: ... glabrata plasmid pMJ22 82 (obtained from Addgene) using XhoI and NotI restriction sites ...
-
bioRxiv - Cancer Biology 2022Quote: ... and HA-HIF2alpha-pcDNA3 (Addgene plasmid # 18950) plasmids were gifts from Dr Kaelin[42] ...
-
bioRxiv - Bioengineering 2022Quote: ... two packaging plasmids (Addgene #8454 and 8455). 50,000 HEK293T were transduced with a MOI of 10 of each lentivirus in a 24-well format and then selected for blasticidin expression (5 μg/ml ...
-
bioRxiv - Biochemistry 2022Quote: ... TetO-Fuw-PB1 WT (Addgene plasmid # 85746)(30) ...
-
bioRxiv - Neuroscience 2021Quote: The following plasmids were obtained from Addgene: pAAV-hSyn-Cre-WPRE (no ...